Incidental Mutation 'R5497:Atp6v0a1'
ID432431
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101029185 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 215 (V215M)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect probably damaging
Transcript: ENSMUST00000044721
AA Change: V215M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: V215M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092663
AA Change: V215M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: V215M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103110
AA Change: V222M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: V222M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154896
Predicted Effect probably damaging
Transcript: ENSMUST00000168757
AA Change: V215M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: V215M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185166
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 101029204 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 101030420 missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 101055060 missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 101027357 missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 101043957 missense probably benign 0.08
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGTTCTGATGCCACCCAAG -3'
(R):5'- TCATTCCCAGTGAAAGCAGAACTG -3'

Sequencing Primer
(F):5'- CTTTAAAGCTAGGCCTGTAAGC -3'
(R):5'- AACTGAGGGATCTGCAGGCC -3'
Posted On2016-10-05