Incidental Mutation 'R5456:Poln'
ID432750
Institutional Source Beutler Lab
Gene Symbol Poln
Ensembl Gene ENSMUSG00000045102
Gene NameDNA polymerase N
SynonymsPOL4P
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34007179-34169448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34007442 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 845 (L845Q)
Ref Sequence ENSEMBL: ENSMUSP00000144578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000056355] [ENSMUST00000202409] [ENSMUST00000202638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042954
AA Change: L863Q

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102
AA Change: L863Q

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056355
SMART Domains Protein: ENSMUSP00000059313
Gene: ENSMUSG00000048142

DomainStartEndE-ValueType
low complexity region 34 74 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:Acetyltransf_10 146 261 9.4e-13 PFAM
Pfam:Acetyltransf_8 156 280 3e-11 PFAM
Pfam:Acetyltransf_7 177 263 2.8e-13 PFAM
Pfam:Acetyltransf_1 184 262 7.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201251
Predicted Effect possibly damaging
Transcript: ENSMUST00000202409
AA Change: L845Q

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102
AA Change: L845Q

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202638
AA Change: L819Q

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102
AA Change: L819Q

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202825
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced meiotic double-strand breaks at a meiotic recombination hot spot harboring insertion/deletion polymorphisms, but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Poln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Poln APN 5 34122760 missense probably benign 0.17
IGL00938:Poln APN 5 34129224 missense probably damaging 1.00
IGL02081:Poln APN 5 34129139 missense probably benign
IGL02411:Poln APN 5 34113322 nonsense probably null
IGL02440:Poln APN 5 34129130 missense probably damaging 1.00
IGL02484:Poln APN 5 34129377 missense probably damaging 1.00
IGL02577:Poln APN 5 34113335 missense probably benign 0.03
IGL03113:Poln APN 5 34116862 missense probably benign 0.01
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0034:Poln UTSW 5 34115418 missense possibly damaging 0.78
R0068:Poln UTSW 5 34077088 splice site probably benign
R0068:Poln UTSW 5 34077088 splice site probably benign
R0325:Poln UTSW 5 34149764 missense probably benign 0.00
R0578:Poln UTSW 5 34014338 missense probably damaging 1.00
R0631:Poln UTSW 5 34118958 missense possibly damaging 0.93
R1171:Poln UTSW 5 34103940 missense probably damaging 1.00
R1266:Poln UTSW 5 34133109 critical splice donor site probably null
R1418:Poln UTSW 5 34078975 missense probably benign 0.00
R1449:Poln UTSW 5 34014338 missense probably damaging 1.00
R1558:Poln UTSW 5 34032799 missense probably benign 0.04
R1723:Poln UTSW 5 34122672 missense probably benign 0.16
R1806:Poln UTSW 5 34107150 splice site probably benign
R4124:Poln UTSW 5 34103951 missense probably benign 0.32
R4125:Poln UTSW 5 34103951 missense probably benign 0.32
R4128:Poln UTSW 5 34103951 missense probably benign 0.32
R4155:Poln UTSW 5 34009649 missense possibly damaging 0.90
R4353:Poln UTSW 5 34129452 missense probably benign 0.00
R4717:Poln UTSW 5 34129448 missense possibly damaging 0.46
R4788:Poln UTSW 5 34129331 missense probably benign 0.30
R4981:Poln UTSW 5 34107085 critical splice donor site probably null
R6020:Poln UTSW 5 34109431 missense probably damaging 0.99
R6484:Poln UTSW 5 34129513 missense probably benign 0.01
R7134:Poln UTSW 5 34118996 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTCCCAGTTGTCCCACAAAG -3'
(R):5'- AATGTGTGGCTGCTCTCTC -3'

Sequencing Primer
(F):5'- GTATCAGTTTAGCCCTCACAGAG -3'
(R):5'- GGCTGCTCTCTCTGTAGAAG -3'
Posted On2016-10-06