Incidental Mutation 'R5562:4930451G09Rik'
List |< first << previous [record 70 of 1920] next >> last >|
ID436680
Institutional Source Beutler Lab
Gene Symbol 4930451G09Rik
Ensembl Gene ENSMUSG00000022543
Gene NameRIKEN cDNA 4930451G09 gene
Synonyms
MMRRC Submission 043119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5562 (G1)
Quality Score218
Status Not validated
Chromosome16
Chromosomal Location4968936-4978962 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to A at 4974076 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090457]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090457
SMART Domains Protein: ENSMUSP00000087942
Gene: ENSMUSG00000022543

DomainStartEndE-ValueType
Pfam:DUF4701 1 195 7.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229669
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a7 G A 19: 20,702,264 Q383* probably null Het
Alkbh3 A T 2: 93,996,379 probably null Het
Amotl1 G A 9: 14,575,297 P434S possibly damaging Het
Arfgef1 T C 1: 10,144,746 E1641G probably damaging Het
Arih2 T C 9: 108,607,347 T422A probably damaging Het
C7 A T 15: 5,031,915 Y317* probably null Het
Car4 A T 11: 84,964,098 M91L probably benign Het
Ccdc7a T C 8: 129,058,785 D98G possibly damaging Het
Cdc25b A G 2: 131,194,758 M493V probably damaging Het
Cdhr3 C G 12: 33,051,055 R452T probably benign Het
Col6a2 G A 10: 76,599,675 Q909* probably null Het
Cyp2j8 A G 4: 96,470,653 I343T probably damaging Het
Dcstamp G A 15: 39,754,402 C69Y possibly damaging Het
Efhc1 C T 1: 20,972,880 T341I probably damaging Het
Elovl2 A G 13: 41,185,296 *276Q probably null Het
Fnip1 T A 11: 54,489,342 probably null Het
Foxc1 A G 13: 31,807,590 H128R probably damaging Het
Gm6768 T A 12: 119,262,222 noncoding transcript Het
Gpr107 C T 2: 31,152,363 A2V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Kif15 A T 9: 122,978,016 Q44H probably damaging Het
Masp1 T C 16: 23,465,167 probably null Het
Muc5b T C 7: 141,847,238 I530T unknown Het
Nudt7 C A 8: 114,147,983 A93D probably damaging Het
Olfr1133 T C 2: 87,645,719 I135V probably benign Het
Pcdha8 A G 18: 36,992,971 T169A possibly damaging Het
Prnp A G 2: 131,937,031 D201G probably damaging Het
Serinc1 G A 10: 57,524,051 Q167* probably null Het
Slc13a5 A G 11: 72,262,039 V35A probably damaging Het
Slc30a6 C T 17: 74,412,705 T220I possibly damaging Het
Slc7a7 T A 14: 54,408,812 M65L probably benign Het
Slc9a3r2 A G 17: 24,641,824 V137A probably benign Het
Speg T A 1: 75,427,056 L2627Q probably damaging Het
Tank A G 2: 61,650,208 T363A possibly damaging Het
Taok3 T A 5: 117,250,964 L478Q probably damaging Het
Trim55 A T 3: 19,659,153 M123L probably benign Het
Trpm2 A G 10: 77,959,939 V118A possibly damaging Het
Ttn A T 2: 76,770,459 Y17114N probably damaging Het
Unc5c A G 3: 141,768,530 T214A probably damaging Het
Ush2a T A 1: 188,576,217 V2021E probably damaging Het
Utp4 G A 8: 106,922,925 D669N probably benign Het
Zfp560 G T 9: 20,350,587 Y89* probably null Het
Zfp64 A G 2: 168,925,722 S657P probably benign Het
Other mutations in 4930451G09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:4930451G09Rik APN 16 4974071 exon noncoding transcript
IGL03052:4930451G09Rik APN 16 4977494 splice site noncoding transcript
R0392:4930451G09Rik UTSW 16 4977499 splice site noncoding transcript
R4851:4930451G09Rik UTSW 16 4976274 exon noncoding transcript
R5868:4930451G09Rik UTSW 16 4974068 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCTACATTTTGAAAGCTGTTTGCC -3'
(R):5'- GCAATCTGAACCTCTGCTTTAC -3'

Sequencing Primer
(F):5'- AAGCTGTTTGCCAAGTGGAGC -3'
(R):5'- GAACCTCTGCTTTACCATGAAG -3'
Posted On2016-10-24