Incidental Mutation 'R5563:Prtg'
ID436707
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Nameprotogenin
SynonymsIgdcc5, A230098A12Rik
MMRRC Submission 043120-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R5563 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72806874-72917291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72856898 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 551 (R551H)
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
Predicted Effect probably damaging
Transcript: ENSMUST00000055535
AA Change: R551H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: R551H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Actn3 T C 19: 4,872,316 H101R probably damaging Het
Akp3 T C 1: 87,125,924 S174P probably damaging Het
Aldh5a1 C A 13: 24,918,626 A285S possibly damaging Het
Atp7b G A 8: 22,028,714 P36L possibly damaging Het
Cdh20 C T 1: 104,947,357 P288L probably benign Het
Fktn T A 4: 53,761,327 N481K probably damaging Het
Fmo5 C A 3: 97,638,891 H173Q probably damaging Het
Fnip1 A G 11: 54,504,862 R1021G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grin2a A G 16: 9,707,717 F337L probably benign Het
Ighv3-1 T A 12: 113,964,586 Y51F probably benign Het
Jcad A G 18: 4,673,944 K569E possibly damaging Het
Mars T C 10: 127,308,661 Q170R probably benign Het
Mfsd4b2 C T 10: 39,922,042 E106K probably benign Het
Mical2 A G 7: 112,314,978 D285G probably damaging Het
Mpp4 A G 1: 59,124,629 probably null Het
Npat A G 9: 53,563,127 I740V probably damaging Het
Parp6 G A 9: 59,628,673 probably null Het
Plin2 T C 4: 86,662,104 K140R probably benign Het
Prdm2 T C 4: 143,134,630 T697A probably benign Het
Prkaa1 A G 15: 5,169,956 E179G probably damaging Het
Psd4 A G 2: 24,394,885 R254G probably benign Het
Rhpn2 T A 7: 35,371,227 L194H probably damaging Het
Sp7 T C 15: 102,359,320 D17G possibly damaging Het
Topbp1 T C 9: 103,311,513 V128A possibly damaging Het
Uba5 G T 9: 104,049,247 T372K probably benign Het
Vmn2r13 T A 5: 109,173,980 I284L probably benign Het
Vmn2r68 T C 7: 85,222,075 T667A probably damaging Het
Other mutations in Prtg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Prtg APN 9 72809644 missense probably damaging 1.00
IGL00942:Prtg APN 9 72892340 missense possibly damaging 0.82
IGL01821:Prtg APN 9 72911937 missense probably damaging 0.98
IGL01901:Prtg APN 9 72855066 missense probably damaging 1.00
IGL02143:Prtg APN 9 72892324 missense probably damaging 1.00
IGL02232:Prtg APN 9 72851489 missense probably damaging 1.00
IGL02451:Prtg APN 9 72856999 missense possibly damaging 0.95
IGL02510:Prtg APN 9 72890869 missense probably damaging 0.99
IGL02739:Prtg APN 9 72851585 missense possibly damaging 0.92
IGL03136:Prtg APN 9 72856985 missense possibly damaging 0.91
FR4548:Prtg UTSW 9 72857081 critical splice donor site probably benign
FR4589:Prtg UTSW 9 72856865 missense probably damaging 1.00
FR4737:Prtg UTSW 9 72857081 critical splice donor site probably benign
R0130:Prtg UTSW 9 72809716 missense probably damaging 1.00
R0321:Prtg UTSW 9 72848025 missense possibly damaging 0.83
R0390:Prtg UTSW 9 72844958 missense probably benign 0.24
R0900:Prtg UTSW 9 72844943 missense probably benign
R1121:Prtg UTSW 9 72906167 missense probably benign 0.15
R1438:Prtg UTSW 9 72910750 splice site probably benign
R1537:Prtg UTSW 9 72809757 missense probably benign 0.00
R1590:Prtg UTSW 9 72842807 missense probably benign
R1626:Prtg UTSW 9 72844911 missense probably damaging 1.00
R1965:Prtg UTSW 9 72848322 missense probably benign 0.27
R1993:Prtg UTSW 9 72844896 missense probably benign
R2351:Prtg UTSW 9 72856824 missense probably damaging 1.00
R3737:Prtg UTSW 9 72842709 nonsense probably null
R3921:Prtg UTSW 9 72848347 missense probably damaging 0.98
R4035:Prtg UTSW 9 72842709 nonsense probably null
R4378:Prtg UTSW 9 72842760 missense possibly damaging 0.91
R4687:Prtg UTSW 9 72890798 missense probably damaging 1.00
R5469:Prtg UTSW 9 72891965 missense probably damaging 0.98
R5556:Prtg UTSW 9 72851704 missense probably damaging 1.00
R5710:Prtg UTSW 9 72809640 missense probably damaging 1.00
R5738:Prtg UTSW 9 72912006 missense probably benign 0.16
R5868:Prtg UTSW 9 72809717 nonsense probably null
R5961:Prtg UTSW 9 72856946 missense probably benign
R5964:Prtg UTSW 9 72892254 missense probably benign 0.41
R6217:Prtg UTSW 9 72904794 missense probably damaging 1.00
R6306:Prtg UTSW 9 72906186 missense probably benign 0.42
R6395:Prtg UTSW 9 72912132 missense possibly damaging 0.80
R6455:Prtg UTSW 9 72907856 missense probably damaging 1.00
R6673:Prtg UTSW 9 72851682 missense probably damaging 0.99
R6985:Prtg UTSW 9 72851501 missense probably damaging 1.00
R7014:Prtg UTSW 9 72891985 missense possibly damaging 0.95
R7233:Prtg UTSW 9 72911991 missense probably benign 0.00
R7261:Prtg UTSW 9 72907835 missense possibly damaging 0.94
R7324:Prtg UTSW 9 72890840 missense probably damaging 0.96
R7372:Prtg UTSW 9 72851566 nonsense probably null
X0028:Prtg UTSW 9 72851716 missense possibly damaging 0.55
X0064:Prtg UTSW 9 72904892 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAAGCATCTCCAGTGTGACCATG -3'
(R):5'- TTTCACGCTCGTAGCCTTGG -3'

Sequencing Primer
(F):5'- GCATCTCCAGTGTGACCATGTTATG -3'
(R):5'- GGCGTCCTGTGTGAGGTCC -3'
Posted On2016-10-24