Incidental Mutation 'R5582:Setd5'
ID438499
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission 043136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5582 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113114925 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 217 (Y217H)
Ref Sequence ENSEMBL: ENSMUSP00000047398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: Y217H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: Y217H

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113155
AA Change: Y236H

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: Y236H

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113157
AA Change: Y236H

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: Y236H

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141072
AA Change: Y459H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142215
AA Change: Y294H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204377
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,636,639 probably null Het
Agxt2 A G 15: 10,399,159 D444G probably damaging Het
Aldh1b1 G T 4: 45,802,750 R96L probably damaging Het
Ank2 T C 3: 126,946,305 probably benign Het
Apob A G 12: 8,010,788 Y3090C probably damaging Het
Bbx A G 16: 50,223,356 S647P probably damaging Het
Brinp2 T C 1: 158,249,409 Y372C probably damaging Het
Btaf1 T C 19: 36,988,173 probably null Het
Cdk5rap1 T A 2: 154,345,974 E477D probably benign Het
Cfap65 G A 1: 74,907,518 probably benign Het
Chdh A G 14: 30,036,859 Y587C probably damaging Het
Chek2 T C 5: 110,868,035 V472A probably damaging Het
Clasrp A C 7: 19,586,856 I326S probably damaging Het
Clic6 A T 16: 92,499,454 Q334L possibly damaging Het
Cyp2d11 A T 15: 82,392,118 probably null Het
Entpd7 T C 19: 43,704,994 I171T probably damaging Het
Fosl1 T C 19: 5,455,267 probably benign Het
Gm10130 T C 2: 150,363,052 probably benign Het
Gm6124 A G 7: 39,220,198 noncoding transcript Het
H3f3a A T 1: 180,810,085 probably benign Het
Hs1bp3 AGAGGAGGAGGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGGAGGAGGAGG 12: 8,324,048 probably benign Het
Idh2 CCAGGGC CC 7: 80,098,339 probably null Het
Igkv3-7 A G 6: 70,608,006 Y110C probably damaging Het
Ints9 C T 14: 65,028,896 T399M possibly damaging Het
Kctd19 G A 8: 105,408,443 T62M probably damaging Het
Lsmem1 A G 12: 40,180,644 probably null Het
Obscn T C 11: 59,099,976 probably null Het
Olfr340 T C 2: 36,453,221 I212T probably benign Het
Olfr748 T C 14: 50,710,968 Y213H probably damaging Het
Otop3 T A 11: 115,339,339 M14K unknown Het
Pibf1 C T 14: 99,137,130 A335V possibly damaging Het
Pkd1l2 A T 8: 117,040,783 L1256* probably null Het
Plbd2 T C 5: 120,493,106 E202G probably benign Het
Ppp1r37 A G 7: 19,532,294 S516P probably damaging Het
Ppt2 G A 17: 34,617,399 T229M probably damaging Het
Prr14 A T 7: 127,476,397 I526F probably damaging Het
Scel T C 14: 103,583,139 probably benign Het
Scn9a A T 2: 66,565,029 probably benign Het
Senp6 T A 9: 80,089,876 D57E possibly damaging Het
Sgcg T C 14: 61,225,305 T198A probably damaging Het
Sipa1 C T 19: 5,654,701 G622D probably benign Het
Slc27a2 C T 2: 126,564,690 A98V probably damaging Het
Slitrk3 G T 3: 73,050,404 P345Q probably benign Het
Slx4 T C 16: 3,985,788 D1054G possibly damaging Het
Sned1 A T 1: 93,282,361 T898S probably damaging Het
Tg C T 15: 66,693,435 P1209S probably damaging Het
Tmem63b C A 17: 45,667,763 V294L probably benign Het
Tnks G A 8: 34,940,861 R238C probably benign Het
Tsn G A 1: 118,305,214 T120I probably damaging Het
Txnrd1 T A 10: 82,895,980 F479I possibly damaging Het
Ubr1 T C 2: 120,915,407 M849V probably benign Het
Usp13 T C 3: 32,911,589 S574P probably damaging Het
Vmn1r69 A G 7: 10,580,508 Y20H probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCATGAAACCAGTAATGGATG -3'
(R):5'- AGCTCTTACCTGCATTTGGGAAC -3'

Sequencing Primer
(F):5'- TTGAAGGTGTCCAAGACCTC -3'
(R):5'- GGTTTGCCCACAAATTCC -3'
Posted On2016-10-26