Incidental Mutation 'R5585:Rtn3'
ID438683
Institutional Source Beutler Lab
Gene Symbol Rtn3
Ensembl Gene ENSMUSG00000024758
Gene Namereticulon 3
Synonyms
MMRRC Submission 043139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R5585 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7425901-7483289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7458195 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 125 (P125L)
Ref Sequence ENSEMBL: ENSMUSP00000085496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065304
AA Change: P144L

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758
AA Change: P144L

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088169
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088171
AA Change: P125L

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758
AA Change: P125L

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik A T 17: 45,733,744 I17N unknown Het
4932414N04Rik A G 2: 68,741,426 T549A probably benign Het
9330159F19Rik C A 10: 29,225,275 S548Y possibly damaging Het
Aanat A G 11: 116,596,973 Y166C probably damaging Het
Adra2a G T 19: 54,046,239 A9S probably benign Het
Ap4m1 A G 5: 138,172,240 Y17C probably damaging Het
Arhgap33 T G 7: 30,523,835 M891L probably benign Het
Calm5 A G 13: 3,854,372 D22G possibly damaging Het
Ccdc15 C T 9: 37,277,403 R795H probably benign Het
Cngb1 T A 8: 95,263,139 I323F probably damaging Het
Cyp26b1 A G 6: 84,577,189 F74L probably damaging Het
Dpagt1 G A 9: 44,329,142 probably null Het
Ercc8 C T 13: 108,175,589 P196S probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Hfm1 G A 5: 106,911,439 S239L probably benign Het
Hgf A G 5: 16,564,801 D91G possibly damaging Het
Lefty2 T A 1: 180,893,263 V27D possibly damaging Het
Lrp2 G A 2: 69,464,624 T3450I possibly damaging Het
Lrrc38 A G 4: 143,350,391 I75V probably damaging Het
Ncor2 C A 5: 125,067,911 E556* probably null Het
Nedd9 A G 13: 41,316,474 L401P probably damaging Het
Nfatc4 T C 14: 55,826,755 L163P probably damaging Het
Nln T C 13: 104,025,061 N667S possibly damaging Het
Olfr1153 A G 2: 87,896,675 T159A possibly damaging Het
Pnpla8 T C 12: 44,283,064 I133T probably benign Het
Psma1 C T 7: 114,274,067 G12S probably damaging Het
Psmd3 G A 11: 98,682,881 G51D possibly damaging Het
Ptprb A G 10: 116,380,854 Q1959R probably damaging Het
Rhbdf1 A G 11: 32,210,222 probably null Het
Rnf167 T C 11: 70,649,482 V110A probably damaging Het
Rrp9 C T 9: 106,485,326 S470F probably benign Het
Scube1 C T 15: 83,676,923 C156Y probably damaging Het
Tgm2 A T 2: 158,131,455 Y245* probably null Het
Timeless T C 10: 128,240,243 I68T probably damaging Het
Ttn A G 2: 76,814,710 S12934P probably damaging Het
Vwa5b2 T A 16: 20,594,678 Y214* probably null Het
Yars2 T A 16: 16,304,620 N7K probably damaging Het
Zfp142 G A 1: 74,578,245 Q150* probably null Het
Zfp995 C T 17: 21,887,358 probably benign Het
Other mutations in Rtn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Rtn3 APN 19 7435069 missense probably damaging 1.00
IGL01025:Rtn3 APN 19 7483041 missense unknown
IGL01347:Rtn3 APN 19 7457280 missense probably benign 0.01
IGL01845:Rtn3 APN 19 7457876 missense probably damaging 1.00
IGL02217:Rtn3 APN 19 7435084 missense probably damaging 0.99
IGL03024:Rtn3 APN 19 7483090 utr 5 prime probably benign
R0399:Rtn3 UTSW 19 7457876 missense probably damaging 1.00
R0633:Rtn3 UTSW 19 7457593 missense probably benign 0.03
R0826:Rtn3 UTSW 19 7467880 intron probably benign
R1327:Rtn3 UTSW 19 7431011 missense possibly damaging 0.81
R1735:Rtn3 UTSW 19 7457911 missense probably damaging 0.96
R2093:Rtn3 UTSW 19 7456850 missense probably damaging 1.00
R3116:Rtn3 UTSW 19 7431990 missense probably damaging 1.00
R3894:Rtn3 UTSW 19 7435085 missense probably damaging 1.00
R3961:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3962:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3963:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R4161:Rtn3 UTSW 19 7483079 missense probably benign 0.38
R4960:Rtn3 UTSW 19 7456521 missense probably damaging 1.00
R5735:Rtn3 UTSW 19 7456692 missense probably damaging 0.99
R5796:Rtn3 UTSW 19 7457467 missense possibly damaging 0.48
R5807:Rtn3 UTSW 19 7456827 missense probably damaging 1.00
R5864:Rtn3 UTSW 19 7435111 missense probably damaging 1.00
R6322:Rtn3 UTSW 19 7458138 missense possibly damaging 0.60
R6703:Rtn3 UTSW 19 7435045 missense probably damaging 1.00
R6885:Rtn3 UTSW 19 7458331 missense probably benign 0.31
R6888:Rtn3 UTSW 19 7457249 missense probably benign 0.00
R6989:Rtn3 UTSW 19 7456491 missense possibly damaging 0.95
R6992:Rtn3 UTSW 19 7435124 missense probably damaging 1.00
X0060:Rtn3 UTSW 19 7432571 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAAAATCCAGTGCACTTCTGTCC -3'
(R):5'- CGGGATTGAGCTCTCTTTGC -3'

Sequencing Primer
(F):5'- GTCCTCCCCATCTGGAACCTTG -3'
(R):5'- CTGATGAGCCACCTTCAAAAAGTATG -3'
Posted On2016-10-26