Incidental Mutation 'R5513:Dab2ip'
ID440155
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Namedisabled 2 interacting protein
Synonyms2310011D08Rik, AIP1
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35558266-35730994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35710254 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 294 (H294L)
Ref Sequence ENSEMBL: ENSMUSP00000122341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000112992] [ENSMUST00000135741] [ENSMUST00000145698]
Predicted Effect probably benign
Transcript: ENSMUST00000065001
AA Change: H286L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883
AA Change: H286L

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091010
AA Change: H351L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883
AA Change: H351L

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112983
AA Change: H227L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883
AA Change: H227L

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112986
AA Change: H323L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883
AA Change: H323L

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112987
AA Change: H294L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883
AA Change: H294L

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112992
AA Change: H351L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883
AA Change: H351L

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124098
AA Change: H244L
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883
AA Change: H244L

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135741
AA Change: H294L

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: H294L

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138957
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156465
Predicted Effect probably benign
Transcript: ENSMUST00000156669
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35720013 missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35707775 missense probably benign 0.25
IGL00902:Dab2ip APN 2 35717112 missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35708877 missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35643897 missense probably benign 0.27
R0097:Dab2ip UTSW 2 35718916 missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35692376 critical splice donor site probably null
R0184:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1388:Dab2ip UTSW 2 35721256 intron probably benign
R1442:Dab2ip UTSW 2 35710256 missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1665:Dab2ip UTSW 2 35720278 missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35718815 missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35643891 nonsense probably null
R3819:Dab2ip UTSW 2 35713210 missense probably damaging 1.00
R4333:Dab2ip UTSW 2 35661620 makesense probably null
R4869:Dab2ip UTSW 2 35720037 missense probably damaging 1.00
R4894:Dab2ip UTSW 2 35730527 utr 3 prime probably benign
R5035:Dab2ip UTSW 2 35709941 missense probably benign 0.03
R5180:Dab2ip UTSW 2 35720491 missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35709991 missense probably benign 0.25
R5579:Dab2ip UTSW 2 35715327 nonsense probably null
R5829:Dab2ip UTSW 2 35707775 unclassified probably benign
R5840:Dab2ip UTSW 2 35727499 missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35715402 missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35692255 nonsense probably null
R6235:Dab2ip UTSW 2 35723087 missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35710266 missense probably benign 0.38
R6571:Dab2ip UTSW 2 35712890 missense probably damaging 1.00
R6813:Dab2ip UTSW 2 35730473 nonsense probably null
X0011:Dab2ip UTSW 2 35723085 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAACGCAACAGCTACCTG -3'
(R):5'- CAGTCCTCCGAAATGAAGCAG -3'

Sequencing Primer
(F):5'- AACAGCTACCTGGGCCTG -3'
(R):5'- TCCGAAATGAAGCAGATCATAAC -3'
Posted On2016-11-08