Incidental Mutation 'R5752:C77080'
ID444833
Institutional Source Beutler Lab
Gene Symbol C77080
Ensembl Gene ENSMUSG00000050390
Gene Nameexpressed sequence C77080
Synonyms
MMRRC Submission 043357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R5752 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location129219578-129261404 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGTG to GGTGTG at 129223980 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052602] [ENSMUST00000097873] [ENSMUST00000106051] [ENSMUST00000106054] [ENSMUST00000145261] [ENSMUST00000146376]
Predicted Effect probably null
Transcript: ENSMUST00000052602
SMART Domains Protein: ENSMUSP00000062395
Gene: ENSMUSG00000050390

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 80 N/A INTRINSIC
low complexity region 209 215 N/A INTRINSIC
low complexity region 273 286 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
low complexity region 393 418 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 492 499 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 555 588 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 657 690 N/A INTRINSIC
low complexity region 724 739 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 810 833 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097873
SMART Domains Protein: ENSMUSP00000095483
Gene: ENSMUSG00000050390

DomainStartEndE-ValueType
low complexity region 164 170 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 348 373 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 447 454 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
low complexity region 510 543 N/A INTRINSIC
low complexity region 576 589 N/A INTRINSIC
low complexity region 612 645 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 698 728 N/A INTRINSIC
low complexity region 765 788 N/A INTRINSIC
low complexity region 871 885 N/A INTRINSIC
low complexity region 943 975 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106051
SMART Domains Protein: ENSMUSP00000101666
Gene: ENSMUSG00000050390

DomainStartEndE-ValueType
low complexity region 152 158 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 435 442 N/A INTRINSIC
low complexity region 475 493 N/A INTRINSIC
low complexity region 498 531 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
low complexity region 600 633 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 686 716 N/A INTRINSIC
low complexity region 753 776 N/A INTRINSIC
low complexity region 859 873 N/A INTRINSIC
low complexity region 931 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106054
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145261
Predicted Effect probably benign
Transcript: ENSMUST00000146376
Meta Mutation Damage Score 0.6536 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,202 Y268C probably damaging Het
A330017A19Rik C A 17: 46,890,040 probably benign Het
Aldh1l2 C A 10: 83,520,380 G49C probably damaging Het
Arhgap26 G A 18: 39,286,672 E11K probably damaging Het
Asns C T 6: 7,689,365 G46S probably damaging Het
Atrn G T 2: 130,906,544 probably benign Het
Cep126 A C 9: 8,120,745 Y92* probably null Het
Cfap69 T C 5: 5,589,204 T567A probably damaging Het
Clgn T A 8: 83,397,041 Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 K793N possibly damaging Het
Cxcl9 C A 5: 92,323,856 M108I probably benign Het
Cyp4f37 A T 17: 32,631,332 I318F probably damaging Het
Daam1 T C 12: 71,946,546 M363T unknown Het
Dnajc13 A C 9: 104,192,774 probably null Het
Entpd2 G A 2: 25,399,769 probably benign Het
F3 T A 3: 121,732,404 N205K probably damaging Het
Fat2 A T 11: 55,289,237 F1426Y possibly damaging Het
Galnt6 A T 15: 100,704,126 F267I probably damaging Het
Gm1322 G A 2: 67,184,635 noncoding transcript Het
Gm6768 A G 12: 119,262,614 noncoding transcript Het
Gm960 C A 19: 4,626,020 A695S probably benign Het
Hdgfl3 A C 7: 81,899,703 S143A possibly damaging Het
Ints7 T A 1: 191,575,893 D12E probably benign Het
Kank3 A G 17: 33,818,063 T114A probably benign Het
Lrp1b A G 2: 41,295,612 Y1364H probably damaging Het
Mef2b A G 8: 70,165,617 T116A possibly damaging Het
Megf8 C T 7: 25,355,114 T1885I probably damaging Het
Mrps11 A G 7: 78,783,595 K30E probably benign Het
Naca T A 10: 128,041,928 probably benign Het
Olfr521 T C 7: 99,767,948 I262T probably benign Het
Paip2b C T 6: 83,831,270 probably null Het
Plcb2 G T 2: 118,711,051 probably benign Het
Plcd4 A G 1: 74,547,972 probably null Het
Pnpla8 A G 12: 44,282,887 N74S probably benign Het
Pot1b A T 17: 55,687,834 I276N probably damaging Het
Qprt C T 7: 127,109,244 G5D probably benign Het
Rab11fip1 T C 8: 27,156,586 N154S probably damaging Het
Rin3 G A 12: 102,313,119 probably benign Het
Sdf4 C T 4: 155,996,304 P37S probably damaging Het
Selp A T 1: 164,137,242 D491V probably damaging Het
Sh3gl3 A G 7: 82,174,948 probably benign Het
Sp110 G C 1: 85,577,202 probably benign Het
Tas2r134 A G 2: 51,627,868 R120G probably damaging Het
Tgfbr3 T C 5: 107,139,807 R509G probably benign Het
Tle3 T A 9: 61,407,471 Y231N probably damaging Het
Ttc41 C T 10: 86,758,346 T881I probably benign Het
Ttll8 T C 15: 88,932,728 Y271C probably benign Het
Ttn A T 2: 76,947,984 I1307K possibly damaging Het
Ube2k A G 5: 65,566,068 D48G probably damaging Het
Vcan T C 13: 89,679,950 T3126A probably damaging Het
Vps13d T C 4: 145,148,970 T1656A probably benign Het
Zzz3 C A 3: 152,452,122 S777R possibly damaging Het
Other mutations in C77080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:C77080 APN 4 129222796 unclassified probably null
IGL02654:C77080 APN 4 129222319 missense probably damaging 1.00
IGL02797:C77080 APN 4 129223311 missense probably damaging 0.99
IGL03231:C77080 APN 4 129223681 missense possibly damaging 0.73
IGL03134:C77080 UTSW 4 129222487 missense possibly damaging 0.53
R0078:C77080 UTSW 4 129227723 splice site probably null
R0418:C77080 UTSW 4 129223684 missense probably damaging 1.00
R1374:C77080 UTSW 4 129222289 missense possibly damaging 0.83
R1632:C77080 UTSW 4 129222666 missense possibly damaging 0.94
R1735:C77080 UTSW 4 129223577 missense probably damaging 1.00
R1970:C77080 UTSW 4 129226017 splice site probably benign
R2018:C77080 UTSW 4 129222355 missense probably damaging 0.96
R2157:C77080 UTSW 4 129224124 missense possibly damaging 0.76
R2201:C77080 UTSW 4 129222639 missense probably benign
R2316:C77080 UTSW 4 129223747 missense probably damaging 1.00
R3751:C77080 UTSW 4 129224322 unclassified probably benign
R4648:C77080 UTSW 4 129221940 missense probably benign 0.00
R4790:C77080 UTSW 4 129223302 missense probably damaging 1.00
R4885:C77080 UTSW 4 129224445 missense probably damaging 1.00
R5217:C77080 UTSW 4 129222685 missense probably damaging 0.99
R5270:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5272:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5273:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5314:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5548:C77080 UTSW 4 129223980 frame shift probably null
R5908:C77080 UTSW 4 129222148 missense probably damaging 0.98
R5960:C77080 UTSW 4 129222072 missense probably damaging 0.99
R7024:C77080 UTSW 4 129225408 missense probably null 0.73
Z1088:C77080 UTSW 4 129222298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGAGTGGCTCCAGTTG -3'
(R):5'- ATGCAGAGGCTGTCATCCAG -3'

Sequencing Primer
(F):5'- CAGTTGTCACTGGACGAGG -3'
(R):5'- TGTCATCCAGCGCCACATC -3'
Posted On2016-11-21