Incidental Mutation 'R1735:C77080'
ID199625
Institutional Source Beutler Lab
Gene Symbol C77080
Ensembl Gene ENSMUSG00000050390
Gene Nameexpressed sequence C77080
Synonyms
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R1735 (G1)
Quality Score209
Status Not validated
Chromosome4
Chromosomal Location129219578-129261404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129223577 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 476 (S476R)
Ref Sequence ENSEMBL: ENSMUSP00000062395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052602] [ENSMUST00000097873] [ENSMUST00000106051] [ENSMUST00000106054] [ENSMUST00000145261] [ENSMUST00000146376]
Predicted Effect probably damaging
Transcript: ENSMUST00000052602
AA Change: S476R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062395
Gene: ENSMUSG00000050390
AA Change: S476R

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 80 N/A INTRINSIC
low complexity region 209 215 N/A INTRINSIC
low complexity region 273 286 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
low complexity region 393 418 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 492 499 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 555 588 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 657 690 N/A INTRINSIC
low complexity region 724 739 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 810 833 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097873
AA Change: S431R

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095483
Gene: ENSMUSG00000050390
AA Change: S431R

DomainStartEndE-ValueType
low complexity region 164 170 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 348 373 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 447 454 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
low complexity region 510 543 N/A INTRINSIC
low complexity region 576 589 N/A INTRINSIC
low complexity region 612 645 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 698 728 N/A INTRINSIC
low complexity region 765 788 N/A INTRINSIC
low complexity region 871 885 N/A INTRINSIC
low complexity region 943 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106051
AA Change: S419R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101666
Gene: ENSMUSG00000050390
AA Change: S419R

DomainStartEndE-ValueType
low complexity region 152 158 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 435 442 N/A INTRINSIC
low complexity region 475 493 N/A INTRINSIC
low complexity region 498 531 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
low complexity region 600 633 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 686 716 N/A INTRINSIC
low complexity region 753 776 N/A INTRINSIC
low complexity region 859 873 N/A INTRINSIC
low complexity region 931 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106054
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137591
Predicted Effect probably benign
Transcript: ENSMUST00000145261
Predicted Effect probably benign
Transcript: ENSMUST00000146376
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in C77080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:C77080 APN 4 129222796 unclassified probably null
IGL02654:C77080 APN 4 129222319 missense probably damaging 1.00
IGL02797:C77080 APN 4 129223311 missense probably damaging 0.99
IGL03231:C77080 APN 4 129223681 missense possibly damaging 0.73
IGL03134:C77080 UTSW 4 129222487 missense possibly damaging 0.53
R0078:C77080 UTSW 4 129227723 splice site probably null
R0418:C77080 UTSW 4 129223684 missense probably damaging 1.00
R1374:C77080 UTSW 4 129222289 missense possibly damaging 0.83
R1632:C77080 UTSW 4 129222666 missense possibly damaging 0.94
R1970:C77080 UTSW 4 129226017 splice site probably benign
R2018:C77080 UTSW 4 129222355 missense probably damaging 0.96
R2157:C77080 UTSW 4 129224124 missense possibly damaging 0.76
R2201:C77080 UTSW 4 129222639 missense probably benign
R2316:C77080 UTSW 4 129223747 missense probably damaging 1.00
R3751:C77080 UTSW 4 129224322 unclassified probably benign
R4648:C77080 UTSW 4 129221940 missense probably benign 0.00
R4790:C77080 UTSW 4 129223302 missense probably damaging 1.00
R4885:C77080 UTSW 4 129224445 missense probably damaging 1.00
R5217:C77080 UTSW 4 129222685 missense probably damaging 0.99
R5270:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5272:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5273:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5314:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5548:C77080 UTSW 4 129223980 frame shift probably null
R5752:C77080 UTSW 4 129223980 frame shift probably null
R5908:C77080 UTSW 4 129222148 missense probably damaging 0.98
R5960:C77080 UTSW 4 129222072 missense probably damaging 0.99
Z1088:C77080 UTSW 4 129222298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTTGAAGGTGAAAGTGTCC -3'
(R):5'- AGTCCTCCGAGACCATTGTGTCTG -3'

Sequencing Primer
(F):5'- GTGGACAAGATACTGCCCC -3'
(R):5'- CATTGTGTCTGATGGTTCCAC -3'
Posted On2014-05-23