Incidental Mutation 'R5833:Iqgap2'
ID449421
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission 043221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5833 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95675372 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 707 (R707H)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: R707H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: R707H

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 T C 5: 8,958,314 Y1161H probably damaging Het
Adcy2 T A 13: 68,738,603 M276L probably benign Het
Adi1 A G 12: 28,681,042 D166G probably benign Het
Arhgap44 T G 11: 65,038,677 E267A probably damaging Het
Arl11 T A 14: 61,311,062 L107Q probably damaging Het
C1qtnf3 A G 15: 10,975,630 D247G probably benign Het
C4b T C 17: 34,730,673 D1481G probably damaging Het
Cacna1a T C 8: 84,518,697 F242L probably damaging Het
Ccnl1 T C 3: 65,948,501 K298E probably benign Het
Dcaf5 A G 12: 80,348,429 V322A probably damaging Het
Ddr2 T C 1: 170,004,696 N175S probably benign Het
Enox1 T A 14: 77,506,939 M21K probably benign Het
Fhad1 T C 4: 142,002,527 D55G probably damaging Het
Gm5157 A G 7: 21,185,393 M75T possibly damaging Het
Gm6309 A G 5: 146,168,318 S262P probably damaging Het
Gpnmb T C 6: 49,044,018 L82P probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Itpripl2 A C 7: 118,489,971 V455G probably benign Het
Kif16b A G 2: 142,707,367 V1087A probably benign Het
Med12l A G 3: 59,265,226 D1801G possibly damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mtmr4 T A 11: 87,605,049 Y570* probably null Het
Osbpl1a G T 18: 12,788,362 N128K probably damaging Het
Pcdhb5 T A 18: 37,321,102 H178Q probably damaging Het
Pdlim1 A T 19: 40,230,545 F214Y probably damaging Het
Qk A T 17: 10,216,387 L236H probably damaging Het
Rexo2 G T 9: 48,468,871 D220E probably benign Het
Rras A G 7: 45,021,291 E195G possibly damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Sp1 T A 15: 102,430,917 M430K possibly damaging Het
Tardbp A C 4: 148,617,660 V86G probably damaging Het
Trim43c A G 9: 88,843,037 Q203R possibly damaging Het
Vmn1r232 A G 17: 20,913,651 L229P probably damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGTAGATGTTCCAGTCCCAG -3'
(R):5'- TGGCCATTGGGTTCCATTTC -3'

Sequencing Primer
(F):5'- GTCCCAGGACTAACTTGTAAGGCTC -3'
(R):5'- ATTGGGTTCCATTTCTGCCTG -3'
Posted On2016-12-20