Incidental Mutation 'R0552:Sptbn1'
ID 45246
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Name spectrin beta, non-erythrocytic 1
Synonyms beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic
MMRRC Submission 038744-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0552 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 30049395-30218175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30095985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 303 (M303T)
Ref Sequence ENSEMBL: ENSMUSP00000011877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
AlphaFold Q62261
Predicted Effect possibly damaging
Transcript: ENSMUST00000006629
AA Change: M303T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: M303T

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000011877
AA Change: M303T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: M303T

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102838
AA Change: M290T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: M290T

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124231
AA Change: M303T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: M303T

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 25,453,026 (GRCm39) N760K probably benign Het
Ahcyl T A 16: 45,974,955 (GRCm39) T141S probably benign Het
Akr1b10 A G 6: 34,369,920 (GRCm39) T216A possibly damaging Het
Arsj A G 3: 126,232,993 (GRCm39) R580G probably benign Het
C9 A T 15: 6,474,918 (GRCm39) I26F probably damaging Het
Cacna2d1 A G 5: 16,533,041 (GRCm39) E578G probably damaging Het
Clca4b C T 3: 144,622,536 (GRCm39) V510I probably benign Het
Dab2 C T 15: 6,464,895 (GRCm39) T561I possibly damaging Het
Golga5 A T 12: 102,450,752 (GRCm39) E12D possibly damaging Het
Hsd17b12 A T 2: 93,874,280 (GRCm39) F208I probably damaging Het
Inf2 A G 12: 112,579,008 (GRCm39) probably benign Het
Kcnh3 T A 15: 99,127,337 (GRCm39) W378R probably damaging Het
Klhdc8b G C 9: 108,326,422 (GRCm39) R158G possibly damaging Het
Klhl41 G A 2: 69,500,554 (GRCm39) R5Q probably benign Het
Lcn3 T C 2: 25,656,421 (GRCm39) probably null Het
Mppe1 A G 18: 67,370,419 (GRCm39) probably null Het
Muc20 G A 16: 32,614,300 (GRCm39) A359V probably damaging Het
Myh14 T C 7: 44,263,105 (GRCm39) D1765G probably damaging Het
Or10j2 T C 1: 173,098,372 (GRCm39) M210T probably benign Het
Or4c10b C T 2: 89,711,235 (GRCm39) Q22* probably null Het
Or5p58 A G 7: 107,693,985 (GRCm39) M264T probably benign Het
Pbrm1 T A 14: 30,757,916 (GRCm39) L182Q probably damaging Het
Pde8a A G 7: 80,967,095 (GRCm39) N412S probably benign Het
Phyh A G 2: 4,940,912 (GRCm39) T271A probably damaging Het
Pkhd1l1 T C 15: 44,352,942 (GRCm39) S258P probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Pyroxd1 A G 6: 142,291,463 (GRCm39) E2G probably benign Het
Ralgapa1 G T 12: 55,723,550 (GRCm39) Q2115K probably benign Het
Rufy3 A G 5: 88,732,129 (GRCm39) E44G possibly damaging Het
Slit2 A T 5: 48,395,721 (GRCm39) N712I probably damaging Het
Ssbp4 A G 8: 71,052,509 (GRCm39) I154T probably benign Het
Syne2 A G 12: 75,977,778 (GRCm39) K1409E probably benign Het
Tfap2b T C 1: 19,304,449 (GRCm39) Y420H probably damaging Het
Tlr5 A G 1: 182,803,261 (GRCm39) probably null Het
Tmprss15 C T 16: 78,821,637 (GRCm39) probably null Het
Tns1 A T 1: 73,959,722 (GRCm39) I418N probably damaging Het
Txlna A T 4: 129,522,984 (GRCm39) V452D probably benign Het
Wdr17 C T 8: 55,146,131 (GRCm39) A90T possibly damaging Het
Zfp563 A T 17: 33,323,659 (GRCm39) S85C possibly damaging Het
Zfp764l1 A T 7: 126,991,504 (GRCm39) I161N possibly damaging Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30,060,818 (GRCm39) nonsense probably null
IGL01098:Sptbn1 APN 11 30,109,385 (GRCm39) missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30,054,623 (GRCm39) missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30,095,979 (GRCm39) missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30,088,496 (GRCm39) missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30,050,659 (GRCm39) missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30,087,427 (GRCm39) missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30,067,871 (GRCm39) missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30,070,990 (GRCm39) missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30,092,129 (GRCm39) missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30,060,783 (GRCm39) missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30,060,783 (GRCm39) missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30,069,491 (GRCm39) missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30,092,293 (GRCm39) missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30,087,239 (GRCm39) missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30,147,747 (GRCm39) missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30,092,247 (GRCm39) missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30,073,855 (GRCm39) missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30,073,855 (GRCm39) missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30,092,289 (GRCm39) missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30,071,545 (GRCm39) missense probably benign
R0389:Sptbn1 UTSW 11 30,089,250 (GRCm39) missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30,099,576 (GRCm39) missense probably damaging 1.00
R0601:Sptbn1 UTSW 11 30,100,008 (GRCm39) missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30,088,979 (GRCm39) missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30,067,903 (GRCm39) missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30,064,739 (GRCm39) missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30,060,902 (GRCm39) missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30,089,016 (GRCm39) missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30,092,201 (GRCm39) missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30,071,591 (GRCm39) missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30,070,785 (GRCm39) missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30,088,637 (GRCm39) missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30,063,909 (GRCm39) missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30,071,498 (GRCm39) missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30,087,301 (GRCm39) missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30,070,783 (GRCm39) missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30,092,245 (GRCm39) missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30,109,371 (GRCm39) missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30,086,124 (GRCm39) missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30,064,781 (GRCm39) missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30,092,414 (GRCm39) missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30,054,469 (GRCm39) missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30,054,559 (GRCm39) missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30,109,293 (GRCm39) critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30,088,360 (GRCm39) splice site probably benign
R2312:Sptbn1 UTSW 11 30,104,249 (GRCm39) missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30,169,686 (GRCm39) missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30,090,593 (GRCm39) missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30,087,335 (GRCm39) missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30,092,329 (GRCm39) missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30,089,114 (GRCm39) missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30,169,597 (GRCm39) missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30,050,660 (GRCm39) missense probably benign
R4707:Sptbn1 UTSW 11 30,087,197 (GRCm39) missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30,104,297 (GRCm39) missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30,067,759 (GRCm39) missense probably benign
R4824:Sptbn1 UTSW 11 30,068,295 (GRCm39) missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30,092,353 (GRCm39) missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30,074,016 (GRCm39) missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30,063,854 (GRCm39) critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30,071,510 (GRCm39) missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30,087,364 (GRCm39) missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30,050,520 (GRCm39) missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30,087,560 (GRCm39) missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30,093,174 (GRCm39) missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30,094,113 (GRCm39) missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30,095,941 (GRCm39) missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30,095,925 (GRCm39) missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30,073,978 (GRCm39) missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30,086,136 (GRCm39) missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30,074,873 (GRCm39) missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30,068,464 (GRCm39) missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30,087,403 (GRCm39) missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30,109,443 (GRCm39) nonsense probably null
R6226:Sptbn1 UTSW 11 30,086,054 (GRCm39) missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30,050,660 (GRCm39) missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30,089,429 (GRCm39) missense possibly damaging 0.56
R6591:Sptbn1 UTSW 11 30,063,984 (GRCm39) missense probably damaging 0.99
R6616:Sptbn1 UTSW 11 30,074,030 (GRCm39) missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30,063,984 (GRCm39) missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30,067,859 (GRCm39) missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30,064,787 (GRCm39) missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30,096,777 (GRCm39) missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30,088,634 (GRCm39) missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30,092,187 (GRCm39) missense probably benign 0.27
R6998:Sptbn1 UTSW 11 30,050,633 (GRCm39) missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30,053,323 (GRCm39) missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30,087,119 (GRCm39) missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30,064,859 (GRCm39) missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30,067,798 (GRCm39) nonsense probably null
R7379:Sptbn1 UTSW 11 30,089,292 (GRCm39) missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30,092,142 (GRCm39) missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30,088,455 (GRCm39) missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30,088,832 (GRCm39) missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30,104,320 (GRCm39) missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30,092,153 (GRCm39) missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30,079,601 (GRCm39) missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30,086,048 (GRCm39) missense probably damaging 1.00
R8060:Sptbn1 UTSW 11 30,051,616 (GRCm39) missense probably damaging 0.99
R8116:Sptbn1 UTSW 11 30,089,117 (GRCm39) missense probably damaging 1.00
R8169:Sptbn1 UTSW 11 30,147,783 (GRCm39) missense possibly damaging 0.62
R8208:Sptbn1 UTSW 11 30,074,972 (GRCm39) missense probably damaging 1.00
R8247:Sptbn1 UTSW 11 30,063,906 (GRCm39) missense possibly damaging 0.84
R8412:Sptbn1 UTSW 11 30,088,457 (GRCm39) missense probably damaging 1.00
R8470:Sptbn1 UTSW 11 30,070,758 (GRCm39) missense possibly damaging 0.78
R8544:Sptbn1 UTSW 11 30,169,750 (GRCm39) start gained probably benign
R8674:Sptbn1 UTSW 11 30,089,352 (GRCm39) missense possibly damaging 0.73
R8846:Sptbn1 UTSW 11 30,075,009 (GRCm39) missense possibly damaging 0.77
R8889:Sptbn1 UTSW 11 30,067,800 (GRCm39) missense probably benign 0.03
R8892:Sptbn1 UTSW 11 30,067,800 (GRCm39) missense probably benign 0.03
R8927:Sptbn1 UTSW 11 30,088,962 (GRCm39) missense probably damaging 1.00
R8928:Sptbn1 UTSW 11 30,088,962 (GRCm39) missense probably damaging 1.00
R8975:Sptbn1 UTSW 11 30,073,869 (GRCm39) missense possibly damaging 0.86
R9115:Sptbn1 UTSW 11 30,087,526 (GRCm39) missense probably damaging 1.00
R9127:Sptbn1 UTSW 11 30,104,356 (GRCm39) missense probably damaging 1.00
R9193:Sptbn1 UTSW 11 30,087,551 (GRCm39) missense possibly damaging 0.77
R9237:Sptbn1 UTSW 11 30,096,803 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30,147,787 (GRCm39) missense probably benign 0.13
Z1176:Sptbn1 UTSW 11 30,087,439 (GRCm39) missense probably damaging 1.00
Z1177:Sptbn1 UTSW 11 30,070,659 (GRCm39) missense probably benign 0.27
Z1177:Sptbn1 UTSW 11 30,064,734 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACGTCTGCTCCCATACTAACG -3'
(R):5'- TTGAGTTAGGCTGCCACTGCTCAC -3'

Sequencing Primer
(F):5'- CGACCATACATTACACGCTG -3'
(R):5'- GCCACTGCTCACAGGTAATAGG -3'
Posted On 2013-06-11