Incidental Mutation 'R1479:Sptbn1'
ID164211
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Namespectrin beta, non-erythrocytic 1
Synonymsnon-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30099395-30268175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30113909 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1957 (C1957R)
Ref Sequence ENSEMBL: ENSMUSP00000099902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
Predicted Effect probably damaging
Transcript: ENSMUST00000006629
AA Change: C1970R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: C1970R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000011877
AA Change: C1970R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: C1970R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102838
AA Change: C1957R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: C1957R

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124231
AA Change: C1970R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: C1970R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127209
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30110818 nonsense probably null
IGL01098:Sptbn1 APN 11 30159385 missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30104623 missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30145979 missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30138496 missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30100659 missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30137427 missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30117871 missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30120990 missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30142129 missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30119491 missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30142293 missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30137239 missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30197747 missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30142247 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30142289 missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30121545 missense probably benign
R0389:Sptbn1 UTSW 11 30139250 missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30149576 missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30145985 missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30150008 missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30138979 missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30117903 missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30110902 missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30139016 missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30142201 missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30121591 missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30120785 missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30138637 missense possibly damaging 0.50
R1496:Sptbn1 UTSW 11 30121498 missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30137301 missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30120783 missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30142245 missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30159371 missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30136124 missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30114781 missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30142414 missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30104469 missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30104559 missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30159293 critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30138360 splice site probably benign
R2312:Sptbn1 UTSW 11 30154249 missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30219686 missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30140593 missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30137335 missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30142329 missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30139114 missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30219597 missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30100660 missense probably benign
R4707:Sptbn1 UTSW 11 30137197 missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30154297 missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30117759 missense probably benign
R4824:Sptbn1 UTSW 11 30118295 missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30142353 missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30124016 missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30113854 critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30121510 missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30137364 missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30100520 missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30137560 missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30143174 missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30144113 missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30145941 missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30145925 missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30123978 missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30136136 missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30124873 missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30118464 missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30137403 missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30159443 nonsense probably null
R6226:Sptbn1 UTSW 11 30136054 missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30100660 missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30139429 missense possibly damaging 0.56
R6590:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6616:Sptbn1 UTSW 11 30124030 missense probably benign 0.08
R6691:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30117859 missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30114787 missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30146777 missense possibly damaging 0.94
R6883:Sptbn1 UTSW 11 30138634 missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30142187 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTAAAGAAGCGTACTCACTTGCACG -3'
(R):5'- ACAGTGTCTGCCTGCATTGCATC -3'

Sequencing Primer
(F):5'- gaaaaactgaaactacactgaacac -3'
(R):5'- GTTACCGAGTTAGCCAGTCCTAAG -3'
Posted On2014-03-28