Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03138:Knl1'

453067

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

Casc5, 2310043D08Rik, 5730505K17Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL03138 (G1)

Quality Score

164

Status

Validated

Chromosome

Chromosomal Location

118877600-118935982 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 118902840 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1514 (V1514F)

Ref Sequence

ENSEMBL: ENSMUSP00000097140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: V1514F

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: V1514F

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000028802
AA Change: V1514F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: V1514F

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000099542
AA Change: V1514F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: V1514F

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Meta Mutation Damage Score

0.1109

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 52,692,862 (GRCm39)		noncoding transcript	Het
Casd1	A	G	6: 4,613,236 (GRCm39)	H118R	probably damaging	Het
Cilp	TGGG	TGG	9: 65,187,412 (GRCm39)		probably null	Het
Cmya5	T	C	13: 93,201,850 (GRCm39)	K3371E	probably damaging	Het
Crb1	CG	C	1: 139,164,824 (GRCm39)		probably null	Het
Dpysl3	T	C	18: 43,458,859 (GRCm39)	T632A	probably benign	Het
Elapor1	T	A	3: 108,379,309 (GRCm39)	N392Y	probably benign	Het
Fbh1	T	C	2: 11,754,320 (GRCm39)		probably benign	Het
Fcna	G	C	2: 25,520,693 (GRCm39)		probably benign	Het
Gbe1	T	A	16: 70,325,951 (GRCm39)		probably benign	Het
Gm4876	T	G	6: 17,171,736 (GRCm39)		noncoding transcript	Het
Gvin-ps6	G	T	7: 106,023,650 (GRCm39)		noncoding transcript	Het
Hsd17b7	C	T	1: 169,780,649 (GRCm39)	E320K	probably damaging	Het
Inhba	T	A	13: 16,192,099 (GRCm39)	D73E	probably benign	Het
Kndc1	A	G	7: 139,519,791 (GRCm39)	N1717D	possibly damaging	Het
Map1b	C	T	13: 99,562,334 (GRCm39)	A2459T	unknown	Het
Mmp1a	TG	TGG	9: 7,465,083 (GRCm38)		probably null	Het
Pias2	T	C	18: 77,237,796 (GRCm39)		probably null	Het
Polr1b	T	C	2: 128,944,908 (GRCm39)	F68S	probably benign	Het
Skic8	T	C	9: 54,635,447 (GRCm39)		probably benign	Het
Slamf1	C	A	1: 171,604,652 (GRCm39)	Q141K	possibly damaging	Het
Speer4c1	A	C	5: 15,919,214 (GRCm39)		probably benign	Het
Tpo	T	C	12: 30,124,170 (GRCm39)	T877A	probably benign	Het
Ugt1a1	AT	A	1: 88,140,093 (GRCm39)		probably null	Het
Vmn1r37	A	G	6: 66,709,172 (GRCm39)	K229R	possibly damaging	Het
Wdr17	T	C	8: 55,102,178 (GRCm39)	D947G	probably damaging	Het
Wiz	G	T	17: 32,578,093 (GRCm39)	T473K	probably damaging	Het
Zmynd12	A	G	4: 119,280,186 (GRCm39)	Y35C	probably damaging	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	118,894,564 (GRCm39)	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	118,932,980 (GRCm39)	missense	probably benign	0.19
IGL00666:Knl1	APN	2	118,900,945 (GRCm39)	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	118,907,461 (GRCm39)	missense	probably benign	0.33
IGL01395:Knl1	APN	2	118,902,047 (GRCm39)	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	118,900,482 (GRCm39)	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	118,934,542 (GRCm39)	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	118,931,255 (GRCm39)	missense	probably benign	0.40
IGL02105:Knl1	APN	2	118,902,289 (GRCm39)	missense	probably benign
IGL02106:Knl1	APN	2	118,902,489 (GRCm39)	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	118,899,633 (GRCm39)	missense	probably benign	0.01
IGL02252:Knl1	APN	2	118,903,021 (GRCm39)	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	118,900,804 (GRCm39)	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	118,901,473 (GRCm39)	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	118,908,450 (GRCm39)	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	118,901,411 (GRCm39)	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	118,919,312 (GRCm39)	missense	probably benign	0.08
IGL03100:Knl1	APN	2	118,931,251 (GRCm39)	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	118,901,098 (GRCm39)	missense	probably benign	0.02
R0023:Knl1	UTSW	2	118,933,030 (GRCm39)	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0078:Knl1	UTSW	2	118,900,373 (GRCm39)	missense	probably benign	0.16
R0178:Knl1	UTSW	2	118,888,886 (GRCm39)	splice site	probably benign
R0295:Knl1	UTSW	2	118,919,320 (GRCm39)	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	118,934,542 (GRCm39)	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	118,898,869 (GRCm39)	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	118,927,916 (GRCm39)	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	118,919,382 (GRCm39)	splice site	probably benign
R0920:Knl1	UTSW	2	118,900,309 (GRCm39)	missense	probably benign	0.00
R1120:Knl1	UTSW	2	118,892,856 (GRCm39)	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	118,901,635 (GRCm39)	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	118,901,670 (GRCm39)	missense	probably benign	0.00
R1241:Knl1	UTSW	2	118,903,054 (GRCm39)	missense	probably benign	0.03
R1387:Knl1	UTSW	2	118,901,211 (GRCm39)	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	118,898,788 (GRCm39)	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	118,902,219 (GRCm39)	missense	probably benign	0.01
R1721:Knl1	UTSW	2	118,906,815 (GRCm39)	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	118,902,300 (GRCm39)	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	118,918,075 (GRCm39)	critical splice donor site	probably null
R2227:Knl1	UTSW	2	118,902,481 (GRCm39)	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	118,902,708 (GRCm39)	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	118,902,762 (GRCm39)	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	118,888,849 (GRCm39)	nonsense	probably null
R3115:Knl1	UTSW	2	118,900,872 (GRCm39)	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	118,899,425 (GRCm39)	missense	probably benign	0.32
R3431:Knl1	UTSW	2	118,892,843 (GRCm39)	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	118,933,060 (GRCm39)	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	118,890,080 (GRCm39)	missense	probably benign	0.00
R4600:Knl1	UTSW	2	118,901,025 (GRCm39)	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	118,899,618 (GRCm39)	nonsense	probably null
R4758:Knl1	UTSW	2	118,902,213 (GRCm39)	frame shift	probably null
R4762:Knl1	UTSW	2	118,902,417 (GRCm39)	missense	probably benign	0.01
R4869:Knl1	UTSW	2	118,902,832 (GRCm39)	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	118,911,994 (GRCm39)	missense	probably benign	0.22
R4935:Knl1	UTSW	2	118,899,438 (GRCm39)	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	118,900,512 (GRCm39)	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	118,899,657 (GRCm39)	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	118,900,176 (GRCm39)	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	118,900,736 (GRCm39)	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	118,901,464 (GRCm39)	missense	probably benign	0.01
R5493:Knl1	UTSW	2	118,899,211 (GRCm39)	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	118,900,833 (GRCm39)	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	118,912,031 (GRCm39)	nonsense	probably null
R5854:Knl1	UTSW	2	118,900,884 (GRCm39)	missense	probably benign	0.02
R5979:Knl1	UTSW	2	118,899,841 (GRCm39)	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	118,924,549 (GRCm39)	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	118,900,767 (GRCm39)	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	118,902,422 (GRCm39)	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	118,899,799 (GRCm39)	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	118,899,484 (GRCm39)	missense	probably benign	0.02
R6608:Knl1	UTSW	2	118,917,093 (GRCm39)	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	118,925,665 (GRCm39)	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	118,901,266 (GRCm39)	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	118,899,780 (GRCm39)	missense	probably benign	0.35
R7270:Knl1	UTSW	2	118,933,003 (GRCm39)	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	118,902,167 (GRCm39)	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	118,901,040 (GRCm39)	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	118,925,707 (GRCm39)	nonsense	probably null
R7408:Knl1	UTSW	2	118,901,073 (GRCm39)	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	118,918,027 (GRCm39)	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	118,901,179 (GRCm39)	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	118,896,460 (GRCm39)	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	118,924,487 (GRCm39)	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	118,925,614 (GRCm39)	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	118,902,037 (GRCm39)	missense	probably benign	0.13
R7847:Knl1	UTSW	2	118,901,457 (GRCm39)	missense	probably benign	0.02
R8423:Knl1	UTSW	2	118,900,513 (GRCm39)	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8727:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8995:Knl1	UTSW	2	118,902,990 (GRCm39)	missense	probably benign	0.11
R9023:Knl1	UTSW	2	118,900,761 (GRCm39)	missense	probably benign	0.27
R9100:Knl1	UTSW	2	118,899,469 (GRCm39)	missense	probably benign	0.02
R9102:Knl1	UTSW	2	118,917,973 (GRCm39)	missense	probably benign	0.22
R9303:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	118,931,224 (GRCm39)	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	118,899,979 (GRCm39)	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	118,887,782 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,907,425 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,899,994 (GRCm39)	missense	probably benign	0.02
R9671:Knl1	UTSW	2	118,901,089 (GRCm39)	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	118,900,381 (GRCm39)	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	118,899,910 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGCTGAAACTACATCTGTACCAC -3'
(R):5'- ACATCATTTTCTTCAACCCGGG -3'

Sequencing Primer
(F):5'- TACATCTGTACCACTAAAAACAGCTG -3'
(R):5'- TGGGCCCTGCAGTTTTC -3'

Posted On

2017-01-27