Incidental Mutation 'R0569:Knl1'
ID46286
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0569 (G1)
Quality Score186
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119097435 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1919 (V1919D)
Ref Sequence ENSEMBL: ENSMUSP00000097140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028802] [ENSMUST00000099542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028802
AA Change: V1919D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: V1919D

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000099542
AA Change: V1919D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: V1919D

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGATAATTTCCCAATCCGGTGCTCCTA -3'
(R):5'- AGCCATGCCACCATGTTCCATT -3'

Sequencing Primer
(F):5'- TTGAACCCCCAGCATTGG -3'
(R):5'- tgatctctagcaaacttcccc -3'
Posted On2013-06-11