Incidental Mutation 'R5847:Trim11'
ID453689
Institutional Source Beutler Lab
Gene Symbol Trim11
Ensembl Gene ENSMUSG00000020455
Gene Nametripartite motif-containing 11
Synonyms
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58978093-58991458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58990593 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 437 (D437E)
Ref Sequence ENSEMBL: ENSMUSP00000104438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047441] [ENSMUST00000093061] [ENSMUST00000108809] [ENSMUST00000108810]
Predicted Effect probably benign
Transcript: ENSMUST00000047441
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093061
AA Change: D421E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090749
Gene: ENSMUSG00000020455
AA Change: D421E

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 285 337 4.1e-24 SMART
SPRY 338 457 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108809
SMART Domains Protein: ENSMUSP00000104437
Gene: ENSMUSG00000020455

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108810
AA Change: D437E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104438
Gene: ENSMUSG00000020455
AA Change: D437E

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 301 353 4.1e-24 SMART
SPRY 354 473 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138587
SMART Domains Protein: ENSMUSP00000121092
Gene: ENSMUSG00000061462

DomainStartEndE-ValueType
IG 2 83 1.28e-1 SMART
low complexity region 186 216 N/A INTRINSIC
SH3 219 282 1.22e0 SMART
Pfam:RhoGEF 313 491 6.1e-22 PFAM
PH 512 622 2.74e-11 SMART
IGc2 642 710 3.73e-12 SMART
IGc2 736 805 1.18e-14 SMART
low complexity region 843 857 N/A INTRINSIC
IGc2 985 1052 1.7e-6 SMART
S_TKc 1083 1336 1.66e-79 SMART
Blast:STYKc 1364 1456 1e-38 BLAST
low complexity region 1460 1475 N/A INTRINSIC
low complexity region 1534 1550 N/A INTRINSIC
low complexity region 1667 1682 N/A INTRINSIC
low complexity region 1720 1740 N/A INTRINSIC
low complexity region 2020 2035 N/A INTRINSIC
IGc2 2059 2127 6.3e-10 SMART
FN3 2141 2219 9.33e-2 SMART
STYKc 2257 2509 8.55e-41 SMART
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Trim11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Trim11 APN 11 58990697 missense probably benign
R0453:Trim11 UTSW 11 58990535 missense probably damaging 1.00
R0565:Trim11 UTSW 11 58990584 missense probably damaging 1.00
R2061:Trim11 UTSW 11 58982063 missense probably damaging 1.00
R4783:Trim11 UTSW 11 58988924 missense probably null 1.00
R5004:Trim11 UTSW 11 58981338 critical splice donor site probably benign
R6027:Trim11 UTSW 11 58978463 missense possibly damaging 0.76
R6928:Trim11 UTSW 11 58988843 missense probably damaging 1.00
R7128:Trim11 UTSW 11 58978277 missense probably damaging 1.00
R7389:Trim11 UTSW 11 58990655 missense probably damaging 1.00
R7485:Trim11 UTSW 11 58978637 missense probably benign 0.00
R7535:Trim11 UTSW 11 58982065 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCGGCGTGTGTAAAGAAAC -3'
(R):5'- CTGTATGGCCAGGACAAAGGAC -3'

Sequencing Primer
(F):5'- CGTGTGTAAAGAAACTGCCAAC -3'
(R):5'- ACCAGGAAAGGTGAAGGGACTTTC -3'
Posted On2017-02-10