Incidental Mutation 'R5900:Znrf3'
ID456281
Institutional Source Beutler Lab
Gene Symbol Znrf3
Ensembl Gene ENSMUSG00000041961
Gene Namezinc and ring finger 3
SynonymsLOC382477
MMRRC Submission 044099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5900 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5276324-5444847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5282110 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 468 (H468N)
Ref Sequence ENSEMBL: ENSMUSP00000105493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109867] [ENSMUST00000172492]
PDB Structure
mouse ZNRF3 ectodomain crystal form I [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form II [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form III [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form IV [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form V, disulfide-bridged S90C variant [X-RAY DIFFRACTION]
Mouse ZNRF3 ectodomain in complex with mouse RSPO2 Fu1-Fu2 crystal form I [X-RAY DIFFRACTION]
Mouse ZNRF3 ectodomain in complex with Xenopus RSPO2 Fu1-Fu2 (Seleno Met) crystal form I [X-RAY DIFFRACTION]
Mouse ZNRF3 ectodomain in complex with Xenopus RSPO2 Fu1-Fu2 (Seleno Met) crystal form II [X-RAY DIFFRACTION]
Structure of ZNRF3 ectodomain [X-RAY DIFFRACTION]
Structure of ZNRF3-RSPO1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000109867
AA Change: H468N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105493
Gene: ENSMUSG00000041961
AA Change: H468N

DomainStartEndE-ValueType
signal peptide 1 52 N/A INTRINSIC
PDB:4CDK|D 53 205 1e-103 PDB
transmembrane domain 218 235 N/A INTRINSIC
RING 290 330 1.56e-6 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172492
AA Change: H372N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134698
Gene: ENSMUSG00000041961
AA Change: H372N

DomainStartEndE-ValueType
PDB:4CDK|D 2 109 5e-70 PDB
transmembrane domain 122 139 N/A INTRINSIC
RING 194 234 1.56e-6 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit complete lethality around birth, aphakia, abnormal lens development and defective enural tube closure in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Abcc12 T C 8: 86,566,520 D13G possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Apoh G T 11: 108,412,017 K269N probably damaging Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Dstyk G A 1: 132,456,979 R737Q probably damaging Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Hkdc1 T C 10: 62,408,666 M214V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Mtus1 A T 8: 41,083,497 V394D possibly damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Serpina9 G A 12: 104,008,871 R8* probably null Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Other mutations in Znrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znrf3 APN 11 5289039 missense probably damaging 1.00
IGL01387:Znrf3 APN 11 5338656 nonsense probably null
IGL02895:Znrf3 APN 11 5289085 missense probably damaging 0.97
R0788:Znrf3 UTSW 11 5281320 missense probably benign 0.04
R1383:Znrf3 UTSW 11 5281994 missense probably damaging 0.96
R1544:Znrf3 UTSW 11 5289066 missense probably damaging 1.00
R1556:Znrf3 UTSW 11 5281347 missense probably benign 0.01
R1586:Znrf3 UTSW 11 5281477 missense probably damaging 1.00
R1852:Znrf3 UTSW 11 5287455 missense possibly damaging 0.94
R1864:Znrf3 UTSW 11 5283373 missense possibly damaging 0.95
R1927:Znrf3 UTSW 11 5281062 missense probably benign 0.28
R2353:Znrf3 UTSW 11 5281170 missense probably damaging 1.00
R2884:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R2885:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R4021:Znrf3 UTSW 11 5281278 missense possibly damaging 0.68
R4811:Znrf3 UTSW 11 5287420 missense probably benign 0.07
R4935:Znrf3 UTSW 11 5283422 missense probably damaging 1.00
R5218:Znrf3 UTSW 11 5281519 missense possibly damaging 0.95
R5584:Znrf3 UTSW 11 5286218 missense probably damaging 1.00
R5698:Znrf3 UTSW 11 5289006 intron probably benign
R5715:Znrf3 UTSW 11 5286239 missense possibly damaging 0.91
R5988:Znrf3 UTSW 11 5281776 missense probably damaging 1.00
R6253:Znrf3 UTSW 11 5280865 missense probably benign 0.14
R7057:Znrf3 UTSW 11 5282442 missense probably benign 0.00
R7062:Znrf3 UTSW 11 5281550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTAGATGTGCTGCCAC -3'
(R):5'- ACACTGCTAACCATGGACCG -3'

Sequencing Primer
(F):5'- ACTCTCCACGTGGGTTGGAG -3'
(R):5'- ATGGGGAGCAGAACCTCTATTCTC -3'
Posted On2017-02-15