Incidental Mutation 'R0503:Zkscan1'
ID47248
Institutional Source Beutler Lab
Gene Symbol Zkscan1
Ensembl Gene ENSMUSG00000029729
Gene Namezinc finger with KRAB and SCAN domains 1
Synonyms9230118B16Rik, KOX18, 9130423L19Rik, 5930429A01Rik
MMRRC Submission 038698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0503 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138085084-138107822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138093326 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 107 (I107N)
Ref Sequence ENSEMBL: ENSMUSP00000106588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019660] [ENSMUST00000066617] [ENSMUST00000110962] [ENSMUST00000110963]
Predicted Effect probably damaging
Transcript: ENSMUST00000019660
AA Change: I107N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019660
Gene: ENSMUSG00000029729
AA Change: I107N

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 1.5e-75 SMART
KRAB 225 285 5.7e-8 SMART
low complexity region 300 314 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
ZnF_C2H2 375 397 1.3e-5 SMART
ZnF_C2H2 403 425 7.3e-6 SMART
ZnF_C2H2 431 453 5.6e-6 SMART
ZnF_C2H2 459 481 4e-7 SMART
ZnF_C2H2 487 509 3.8e-6 SMART
ZnF_C2H2 515 537 5.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066617
AA Change: I107N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068480
Gene: ENSMUSG00000029729
AA Change: I107N

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110962
AA Change: I107N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106587
Gene: ENSMUSG00000029729
AA Change: I107N

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110963
AA Change: I107N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106588
Gene: ENSMUSG00000029729
AA Change: I107N

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,495 H755R possibly damaging Het
Atp2c2 A G 8: 119,734,577 E279G probably null Het
Ccdc65 G T 15: 98,709,160 D83Y probably damaging Het
Cd200r2 T A 16: 44,877,962 M1K probably null Het
Clca4c-ps A T 3: 144,879,822 noncoding transcript Het
Col6a6 A T 9: 105,767,351 M1246K probably benign Het
Comp A T 8: 70,375,734 N130I possibly damaging Het
Crot A G 5: 8,976,075 V304A possibly damaging Het
Dapk1 T A 13: 60,730,848 probably null Het
Dspp A T 5: 104,177,256 D495V unknown Het
Erich2 A T 2: 70,509,699 R169S probably damaging Het
Erich2 C A 2: 70,540,775 S426R unknown Het
Gab1 C T 8: 80,800,142 R109H probably damaging Het
Ggcx GTCTAT GTCTATCTAT 6: 72,429,157 probably null Het
Gria1 T G 11: 57,189,716 V175G probably damaging Het
Hmcn1 C T 1: 150,859,252 V170M probably damaging Het
Irx4 T A 13: 73,266,584 probably null Het
Katnb1 A G 8: 95,095,174 T212A probably damaging Het
Kirrel A G 3: 87,097,802 S80P probably benign Het
Lrrc75b T C 10: 75,553,654 T81A possibly damaging Het
Macf1 A G 4: 123,469,815 S1775P probably damaging Het
Mmp10 A T 9: 7,507,339 I387F probably damaging Het
Mphosph10 A T 7: 64,389,893 C110S probably benign Het
Mpig6b A G 17: 35,064,448 probably benign Het
Mrps27 G T 13: 99,409,795 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mybpc2 A G 7: 44,512,570 probably benign Het
Nbea C T 3: 55,642,836 G2724S possibly damaging Het
Nck2 A G 1: 43,533,568 M1V probably null Het
Nefl T A 14: 68,083,983 D7E probably benign Het
Nktr T A 9: 121,750,740 probably benign Het
Nlrp12 C T 7: 3,249,377 E55K probably damaging Het
Nsun7 T A 5: 66,283,581 probably benign Het
Olfr1214 C T 2: 88,987,978 V75I probably benign Het
Olfr523 T C 7: 140,176,441 V113A possibly damaging Het
Olfr586 A T 7: 103,122,436 M112K possibly damaging Het
Olfr729 T A 14: 50,148,478 Y132F probably damaging Het
Olfr769 T C 10: 129,111,802 T208A probably damaging Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pcdh15 A G 10: 74,210,385 T165A probably damaging Het
Pikfyve A T 1: 65,219,899 H410L probably damaging Het
Polr3c A T 3: 96,713,636 probably null Het
Ptdss2 T A 7: 141,151,797 probably benign Het
Ptprg A G 14: 12,237,138 M1386V possibly damaging Het
Ptpru T C 4: 131,793,643 N784S probably benign Het
Rfx4 T A 10: 84,894,332 I495K possibly damaging Het
Serpina12 C A 12: 104,031,159 A368S probably damaging Het
Tmem39b A C 4: 129,686,986 Y238D possibly damaging Het
Tspan11 T C 6: 127,939,112 W124R probably benign Het
Ttll10 T C 4: 156,047,548 probably benign Het
Tyro3 T C 2: 119,803,230 probably benign Het
Unc79 A G 12: 103,078,868 M644V probably benign Het
Vmn1r196 G A 13: 22,293,387 M65I probably benign Het
Vmn2r85 T C 10: 130,422,740 Y482C probably damaging Het
Zfp940 A G 7: 29,846,020 probably benign Het
Zfyve9 A T 4: 108,719,764 L40* probably null Het
Other mutations in Zkscan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03172:Zkscan1 APN 5 138094002 missense probably benign 0.00
R0078:Zkscan1 UTSW 5 138093101 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0324:Zkscan1 UTSW 5 138097523 missense probably damaging 1.00
R0940:Zkscan1 UTSW 5 138093170 missense probably damaging 1.00
R1879:Zkscan1 UTSW 5 138097148 missense probably damaging 1.00
R1926:Zkscan1 UTSW 5 138101363 missense probably benign 0.33
R3749:Zkscan1 UTSW 5 138101441 missense probably damaging 0.99
R5045:Zkscan1 UTSW 5 138100920 missense probably damaging 1.00
R5391:Zkscan1 UTSW 5 138097101 missense probably benign
R6339:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R6936:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R7178:Zkscan1 UTSW 5 138100930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGTATTCCGCCAACGGTTCAG -3'
(R):5'- CAGAGTGAGCTATATTGCCAAGCCC -3'

Sequencing Primer
(F):5'- GGCGCTTCTGTTACCAGAAC -3'
(R):5'- GCAATAGGCAAGAACTGTTCC -3'
Posted On2013-06-12