Incidental Mutation 'R6049:Cd2bp2'
ID483446
Institutional Source Beutler Lab
Gene Symbol Cd2bp2
Ensembl Gene ENSMUSG00000042502
Gene NameCD2 antigen (cytoplasmic tail) binding protein 2
Synonyms
MMRRC Submission 044217-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R6049 (G1)
Quality Score217.009
Status Validated
Chromosome7
Chromosomal Location127191660-127196050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127193835 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 338 (F338L)
Ref Sequence ENSEMBL: ENSMUSP00000146167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035771] [ENSMUST00000120705] [ENSMUST00000166791] [ENSMUST00000205316] [ENSMUST00000205321] [ENSMUST00000205355] [ENSMUST00000206026] [ENSMUST00000206081] [ENSMUST00000206587]
Predicted Effect probably damaging
Transcript: ENSMUST00000035771
AA Change: F338L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044790
Gene: ENSMUSG00000042502
AA Change: F338L

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120705
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166791
AA Change: F338L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132963
Gene: ENSMUSG00000042502
AA Change: F338L

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175164
Predicted Effect probably damaging
Transcript: ENSMUST00000205316
AA Change: F338L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205321
Predicted Effect probably benign
Transcript: ENSMUST00000205355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205525
Predicted Effect probably benign
Transcript: ENSMUST00000205620
Predicted Effect probably damaging
Transcript: ENSMUST00000206026
AA Change: F338L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206081
Predicted Effect probably benign
Transcript: ENSMUST00000206587
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik G A 4: 103,231,323 H229Y probably benign Het
Abcd2 A G 15: 91,178,236 F500L probably benign Het
Adgb A G 10: 10,378,026 L1190P probably damaging Het
Adgrv1 A G 13: 81,397,354 V5604A probably benign Het
Ank2 T A 3: 126,943,020 T3072S possibly damaging Het
Arhgap39 A G 15: 76,727,401 probably null Het
C6 T C 15: 4,735,172 C117R probably damaging Het
Cacna1a A G 8: 84,638,846 E2206G probably damaging Het
Cngb1 T C 8: 95,270,842 D575G probably damaging Het
Crat A G 2: 30,403,541 F63S probably damaging Het
Crybg3 T C 16: 59,544,054 T2402A probably benign Het
Ctsq A G 13: 61,038,758 probably null Het
Cux1 T C 5: 136,332,710 R248G probably damaging Het
D7Ertd443e T C 7: 134,298,232 H420R probably benign Het
Deup1 A G 9: 15,561,256 F587L possibly damaging Het
Dnah6 T C 6: 73,086,166 K2651R probably benign Het
Dnah7b A G 1: 46,085,602 I144V probably benign Het
Dnajc1 T C 2: 18,231,700 probably null Het
Fscb T C 12: 64,474,320 N124S possibly damaging Het
Gabbr2 A G 4: 46,787,641 Y341H probably damaging Het
Gm5538 A C 3: 59,752,149 D341A probably damaging Het
Greb1 T A 12: 16,681,394 I1648F probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Irs2 A C 8: 11,006,805 D542E probably benign Het
Kat6a T A 8: 22,939,037 H1469Q possibly damaging Het
Kif15 G A 9: 123,011,622 R36K probably damaging Het
Krt42 C T 11: 100,267,060 V193M probably damaging Het
Limch1 A T 5: 67,030,860 E878V probably benign Het
Med18 G T 4: 132,459,713 D158E probably benign Het
Med6 T C 12: 81,591,323 N38S probably damaging Het
Mup13 T C 4: 61,227,597 T76A probably benign Het
Nlrp4b T A 7: 10,714,713 L281* probably null Het
Olfr191 A T 16: 59,086,146 C112* probably null Het
Olfr823 A T 10: 130,112,612 H59Q probably benign Het
Olfr846 C A 9: 19,361,344 G4* probably null Het
Pde4d A T 13: 109,032,585 R54* probably null Het
Pdpk1 A T 17: 24,098,135 Y251* probably null Het
Pdzk1 A G 3: 96,851,663 E128G probably benign Het
Phf12 A G 11: 78,028,170 probably null Het
Pnliprp2 A G 19: 58,760,452 E63G possibly damaging Het
Prkcd T C 14: 30,607,297 E62G possibly damaging Het
Prl7b1 G T 13: 27,606,178 D77E probably benign Het
Rbck1 G T 2: 152,323,174 C85* probably null Het
Rfx3 A T 19: 27,802,395 M481K probably damaging Het
Rmdn3 A G 2: 119,153,425 F159L probably damaging Het
Rpusd3 A C 6: 113,417,841 probably null Het
Rsg1 T A 4: 141,218,162 V108D probably benign Het
Ska1 T C 18: 74,202,600 T100A probably benign Het
Slc1a3 T C 15: 8,645,693 E276G probably damaging Het
Slc27a6 T A 18: 58,598,660 Y361N probably damaging Het
Smc1b A G 15: 85,121,695 L336S probably damaging Het
St7 A G 6: 17,694,348 D46G possibly damaging Het
Supt5 A G 7: 28,315,197 I1059T probably benign Het
Syne1 A T 10: 5,347,926 S1124T possibly damaging Het
Szt2 A G 4: 118,402,988 S54P probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tbc1d7 A C 13: 43,159,360 M19R probably damaging Het
Tbpl2 T C 2: 24,094,992 N47D possibly damaging Het
Tgfbr3 C T 5: 107,118,485 A790T probably damaging Het
Tmem2 A T 19: 21,826,126 Q841L probably benign Het
Tnr T C 1: 159,912,754 V1166A probably damaging Het
Ttn G A 2: 76,846,310 probably benign Het
Other mutations in Cd2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0201:Cd2bp2 UTSW 7 127193828 missense probably damaging 1.00
R0550:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0674:Cd2bp2 UTSW 7 127194836 missense probably damaging 1.00
R1929:Cd2bp2 UTSW 7 127193878 missense probably benign 0.22
R2187:Cd2bp2 UTSW 7 127194791 missense probably benign 0.06
R5877:Cd2bp2 UTSW 7 127194799 missense probably damaging 1.00
R6109:Cd2bp2 UTSW 7 127194815 missense probably damaging 1.00
R7008:Cd2bp2 UTSW 7 127195395 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTACCAGGTGAAGCCAAAAGG -3'
(R):5'- GTATGGACCCTTCACCAGTG -3'

Sequencing Primer
(F):5'- AGCTATGGAGAAGCCCTGGC -3'
(R):5'- TTCACCAGTGCCCAGATGCAG -3'
Posted On2017-07-14