Incidental Mutation 'R6049:Adgb'
ID483456
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6049 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10378026 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1190 (L1190P)
Ref Sequence ENSEMBL: ENSMUSP00000136386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172530
AA Change: L1188P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: L1188P

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179956
AA Change: L1190P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: L1190P

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208717
AA Change: L1164P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik G A 4: 103,231,323 H229Y probably benign Het
Abcd2 A G 15: 91,178,236 F500L probably benign Het
Adgrv1 A G 13: 81,397,354 V5604A probably benign Het
Ank2 T A 3: 126,943,020 T3072S possibly damaging Het
Arhgap39 A G 15: 76,727,401 probably null Het
C6 T C 15: 4,735,172 C117R probably damaging Het
Cacna1a A G 8: 84,638,846 E2206G probably damaging Het
Cd2bp2 A T 7: 127,193,835 F338L probably damaging Het
Cngb1 T C 8: 95,270,842 D575G probably damaging Het
Crat A G 2: 30,403,541 F63S probably damaging Het
Crybg3 T C 16: 59,544,054 T2402A probably benign Het
Ctsq A G 13: 61,038,758 probably null Het
Cux1 T C 5: 136,332,710 R248G probably damaging Het
D7Ertd443e T C 7: 134,298,232 H420R probably benign Het
Deup1 A G 9: 15,561,256 F587L possibly damaging Het
Dnah6 T C 6: 73,086,166 K2651R probably benign Het
Dnah7b A G 1: 46,085,602 I144V probably benign Het
Dnajc1 T C 2: 18,231,700 probably null Het
Fscb T C 12: 64,474,320 N124S possibly damaging Het
Gabbr2 A G 4: 46,787,641 Y341H probably damaging Het
Gm5538 A C 3: 59,752,149 D341A probably damaging Het
Greb1 T A 12: 16,681,394 I1648F probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Irs2 A C 8: 11,006,805 D542E probably benign Het
Kat6a T A 8: 22,939,037 H1469Q possibly damaging Het
Kif15 G A 9: 123,011,622 R36K probably damaging Het
Krt42 C T 11: 100,267,060 V193M probably damaging Het
Limch1 A T 5: 67,030,860 E878V probably benign Het
Med18 G T 4: 132,459,713 D158E probably benign Het
Med6 T C 12: 81,591,323 N38S probably damaging Het
Mup13 T C 4: 61,227,597 T76A probably benign Het
Nlrp4b T A 7: 10,714,713 L281* probably null Het
Olfr191 A T 16: 59,086,146 C112* probably null Het
Olfr823 A T 10: 130,112,612 H59Q probably benign Het
Olfr846 C A 9: 19,361,344 G4* probably null Het
Pde4d A T 13: 109,032,585 R54* probably null Het
Pdpk1 A T 17: 24,098,135 Y251* probably null Het
Pdzk1 A G 3: 96,851,663 E128G probably benign Het
Phf12 A G 11: 78,028,170 probably null Het
Pnliprp2 A G 19: 58,760,452 E63G possibly damaging Het
Prkcd T C 14: 30,607,297 E62G possibly damaging Het
Prl7b1 G T 13: 27,606,178 D77E probably benign Het
Rbck1 G T 2: 152,323,174 C85* probably null Het
Rfx3 A T 19: 27,802,395 M481K probably damaging Het
Rmdn3 A G 2: 119,153,425 F159L probably damaging Het
Rpusd3 A C 6: 113,417,841 probably null Het
Rsg1 T A 4: 141,218,162 V108D probably benign Het
Ska1 T C 18: 74,202,600 T100A probably benign Het
Slc1a3 T C 15: 8,645,693 E276G probably damaging Het
Slc27a6 T A 18: 58,598,660 Y361N probably damaging Het
Smc1b A G 15: 85,121,695 L336S probably damaging Het
St7 A G 6: 17,694,348 D46G possibly damaging Het
Supt5 A G 7: 28,315,197 I1059T probably benign Het
Syne1 A T 10: 5,347,926 S1124T possibly damaging Het
Szt2 A G 4: 118,402,988 S54P probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tbc1d7 A C 13: 43,159,360 M19R probably damaging Het
Tbpl2 T C 2: 24,094,992 N47D possibly damaging Het
Tgfbr3 C T 5: 107,118,485 A790T probably damaging Het
Tmem2 A T 19: 21,826,126 Q841L probably benign Het
Tnr T C 1: 159,912,754 V1166A probably damaging Het
Ttn G A 2: 76,846,310 probably benign Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CAGTTAATGTACCTGTTGTGGC -3'
(R):5'- GGCCAACTCCAATGACTGAC -3'

Sequencing Primer
(F):5'- GTGGCGTGCTAGAATTTTCTTC -3'
(R):5'- TGGGAACTGAACAAGGATCCTCTTC -3'
Posted On2017-07-14