Incidental Mutation 'R6101:Glul'
ID485234
Institutional Source Beutler Lab
Gene Symbol Glul
Ensembl Gene ENSMUSG00000026473
Gene Nameglutamate-ammonia ligase (glutamine synthetase)
SynonymsGS, Glns
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6101 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location153899944-153909723 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 153906431 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 137 (Y137*)
Ref Sequence ENSEMBL: ENSMUSP00000114377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086199] [ENSMUST00000139476] [ENSMUST00000140685]
Predicted Effect probably null
Transcript: ENSMUST00000086199
AA Change: Y137*
SMART Domains Protein: ENSMUSP00000083375
Gene: ENSMUSG00000026473
AA Change: Y137*

DomainStartEndE-ValueType
Pfam:Gln-synt_N 24 104 1.1e-15 PFAM
Gln-synt_C 110 359 6.09e-74 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139476
AA Change: Y137*
SMART Domains Protein: ENSMUSP00000114377
Gene: ENSMUSG00000026473
AA Change: Y137*

DomainStartEndE-ValueType
Pfam:Gln-synt_N 24 104 8.8e-23 PFAM
Pfam:Gln-synt_C 110 199 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140685
SMART Domains Protein: ENSMUSP00000123157
Gene: ENSMUSG00000026473

DomainStartEndE-ValueType
Pfam:Gln-synt_N 24 104 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154576
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glutamine synthetase family. It catalyzes the synthesis of glutamine from glutamate and ammonia in an ATP-dependent reaction. This protein plays a role in ammonia and glutamate detoxification, acid-base homeostasis, cell signaling, and cell proliferation. Glutamine is an abundant amino acid, and is important to the biosynthesis of several amino acids, pyrimidines, and purines. Mutations in this gene are associated with congenital glutamine deficiency, and overexpression of this gene was observed in some primary liver cancer samples. There are six pseudogenes of this gene found on chromosomes 2, 5, 9, 11, and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Embryos homozygous for a reporter/null allele are not viable after E3.5; however, mutant E2.5 embryonic cells can survive in vitro if provided with glutamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Glul
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Glul APN 1 153906476 missense probably benign 0.01
IGL02881:Glul APN 1 153907116 missense probably benign 0.00
R0512:Glul UTSW 1 153905386 intron probably benign
R1455:Glul UTSW 1 153907099 unclassified probably null
R1589:Glul UTSW 1 153905538 intron probably benign
R1922:Glul UTSW 1 153907324 missense probably benign 0.05
R2223:Glul UTSW 1 153906497 critical splice donor site probably null
R3115:Glul UTSW 1 153907292 missense possibly damaging 0.56
R4498:Glul UTSW 1 153907103 nonsense probably null
R4541:Glul UTSW 1 153903036 nonsense probably null
R4595:Glul UTSW 1 153903050 missense possibly damaging 0.95
R4825:Glul UTSW 1 153903044 missense probably benign 0.00
R5714:Glul UTSW 1 153906497 unclassified probably benign
R6058:Glul UTSW 1 153907341 missense probably benign 0.03
R6105:Glul UTSW 1 153906431 nonsense probably null
R6517:Glul UTSW 1 153908033 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCCTTGGTGATAAAACATGGTGG -3'
(R):5'- TGCAAGGTCGGTCTACTGTTAAG -3'

Sequencing Primer
(F):5'- TAAAACATGGTGGTTAGGCCTG -3'
(R):5'- AAGATTCTGCTGCTGGTCTC -3'
Posted On2017-08-16