Incidental Mutation 'R6093:Csde1'
ID486030
Institutional Source Beutler Lab
Gene Symbol Csde1
Ensembl Gene ENSMUSG00000068823
Gene Namecold shock domain containing E1, RNA binding
Synonymsunr, D3Jfr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6093 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103020426-103058186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103052902 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 615 (Y615C)
Ref Sequence ENSEMBL: ENSMUSP00000143503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029446] [ENSMUST00000197488] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199240] [ENSMUST00000199420] [ENSMUST00000199571]
Predicted Effect probably damaging
Transcript: ENSMUST00000029446
AA Change: Y615C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823
AA Change: Y615C

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196685
Predicted Effect probably damaging
Transcript: ENSMUST00000197488
AA Change: Y584C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823
AA Change: Y584C

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197827
AA Change: Y615C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823
AA Change: Y615C

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197844
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect probably damaging
Transcript: ENSMUST00000198180
AA Change: Y584C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823
AA Change: Y584C

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199240
AA Change: Y485C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823
AA Change: Y485C

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199420
AA Change: Y584C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823
AA Change: Y584C

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199571
AA Change: Y584C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823
AA Change: Y584C

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,659,870 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl3 A C 5: 81,646,522 R531S probably benign Het
Ahctf1 T C 1: 179,762,952 D1252G probably benign Het
Ano1 T C 7: 144,611,377 N648S possibly damaging Het
Antxr2 C A 5: 98,030,460 L30F probably damaging Het
Apol9a T A 15: 77,404,420 N249I probably benign Het
Atp2a1 A G 7: 126,446,921 V977A probably damaging Het
Clmn T C 12: 104,771,956 T968A probably benign Het
Clstn2 A T 9: 97,458,210 I703N probably damaging Het
Cnot1 T C 8: 95,748,894 T1051A probably benign Het
Dcaf17 A G 2: 71,082,012 K314E possibly damaging Het
Dnah10 A T 5: 124,753,174 I711F probably benign Het
Duox1 G T 2: 122,347,274 R1513L probably benign Het
Exph5 A G 9: 53,372,617 T333A possibly damaging Het
Fmnl2 A G 2: 53,114,868 D658G probably damaging Het
Gcgr T A 11: 120,538,121 L395Q probably damaging Het
Gm10801 C CGTA 2: 98,663,807 probably null Het
Gm11487 T C 4: 73,402,021 I174V probably benign Het
Greb1 C T 12: 16,684,486 C1501Y probably benign Het
Iqgap2 A G 13: 95,628,963 V1533A probably damaging Het
Kcnc3 A C 7: 44,591,508 D208A probably benign Het
Kctd14 A G 7: 97,454,953 probably benign Het
Mcm5 C A 8: 75,109,746 D13E probably benign Het
Med23 A G 10: 24,878,443 I221V probably benign Het
Myo19 T C 11: 84,885,709 F64L probably damaging Het
Ncapd3 T G 9: 27,056,158 S597A probably damaging Het
Neb A T 2: 52,251,770 Y72* probably null Het
Nrip1 C T 16: 76,294,764 probably benign Het
Olfr196 T A 16: 59,167,967 M59L probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Phkb T A 8: 85,942,329 D328E probably damaging Het
Phyh G T 2: 4,919,085 A6S possibly damaging Het
Pole A T 5: 110,312,090 Q1120L probably benign Het
Rbmxl1 T C 8: 78,505,943 Y257C probably damaging Het
Smurf2 A T 11: 106,868,623 H69Q possibly damaging Het
Tmem167b A T 3: 108,562,123 M1K probably null Het
Tmod4 A T 3: 95,125,618 T22S probably benign Het
Triml1 T C 8: 43,140,718 I149M probably benign Het
Vmn2r108 T C 17: 20,481,140 T33A probably benign Het
Vmn2r76 T A 7: 86,228,261 R525* probably null Het
Zfp109 A T 7: 24,229,133 W292R probably benign Het
Zfp292 C T 4: 34,811,902 A381T probably damaging Het
Zfp791 C T 8: 85,113,506 probably null Het
Other mutations in Csde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Csde1 APN 3 103040525 missense possibly damaging 0.80
IGL01419:Csde1 APN 3 103038770 missense probably damaging 1.00
IGL02147:Csde1 APN 3 103039934 missense probably damaging 1.00
IGL02161:Csde1 APN 3 103050338 missense probably damaging 0.99
IGL02442:Csde1 APN 3 103054819 missense probably benign 0.20
IGL03036:Csde1 APN 3 103043839 missense probably damaging 0.99
R0526:Csde1 UTSW 3 103056426 missense possibly damaging 0.76
R0727:Csde1 UTSW 3 103043638 missense probably benign
R1738:Csde1 UTSW 3 103029177 intron probably benign
R1744:Csde1 UTSW 3 103050315 missense probably benign 0.31
R2007:Csde1 UTSW 3 103044791 missense probably damaging 1.00
R4665:Csde1 UTSW 3 103047072 missense probably damaging 1.00
R4806:Csde1 UTSW 3 103056369 unclassified probably benign
R5202:Csde1 UTSW 3 103039934 missense probably damaging 1.00
R5298:Csde1 UTSW 3 103047209 intron probably null
R5429:Csde1 UTSW 3 103052841 missense possibly damaging 0.75
R5896:Csde1 UTSW 3 103040543 intron probably benign
R6076:Csde1 UTSW 3 103041229 missense possibly damaging 0.82
R6118:Csde1 UTSW 3 103054754 missense probably benign 0.45
R6213:Csde1 UTSW 3 103040514 missense probably damaging 1.00
R6263:Csde1 UTSW 3 103040017 missense probably benign 0.05
R6653:Csde1 UTSW 3 103052868 missense probably damaging 1.00
R6894:Csde1 UTSW 3 103044656 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CACCTTGTGCGAACATTGG -3'
(R):5'- AGCATAGTAATCATTTGCTGCTCAG -3'

Sequencing Primer
(F):5'- ACCTTGTGCGAACATTGGGTTTG -3'
(R):5'- GGTGACCTCATTTTCAAGGAGTC -3'
Posted On2017-08-16