Incidental Mutation 'R0522:Pold3'
ID48636
Institutional Source Beutler Lab
Gene Symbol Pold3
Ensembl Gene ENSMUSG00000030726
Gene Namepolymerase (DNA-directed), delta 3, accessory subunit
SynonymsP66, C85233, P68, GC12, 2410142G14Rik
MMRRC Submission 038715-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0522 (G1)
Quality Score160
Status Validated
Chromosome7
Chromosomal Location100082111-100121565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100121383 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000032969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032969] [ENSMUST00000127128] [ENSMUST00000156202] [ENSMUST00000208184] [ENSMUST00000208670]
Predicted Effect probably damaging
Transcript: ENSMUST00000032969
AA Change: V14A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032969
Gene: ENSMUSG00000030726
AA Change: V14A

DomainStartEndE-ValueType
Pfam:CDC27 19 461 1.6e-142 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127128
AA Change: V14A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000156202
Predicted Effect probably benign
Transcript: ENSMUST00000208184
Predicted Effect probably benign
Transcript: ENSMUST00000208670
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 66-kDa subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein plays a role in regulating the activity of DNA polymerase delta through interactions with other subunits and the processivity cofactor proliferating cell nuclear antigen (PCNA). Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik A C 1: 181,059,747 D299A probably damaging Het
Adgre5 A G 8: 83,730,176 I192T probably benign Het
Adgrl3 T C 5: 81,726,801 Y982H possibly damaging Het
Adgrv1 T A 13: 81,528,442 probably benign Het
Alms1 T C 6: 85,621,615 V1610A probably benign Het
Ankrd24 T C 10: 81,636,355 probably benign Het
C2cd3 A G 7: 100,395,222 N337S probably benign Het
Cdc40 T C 10: 40,857,612 Y114C probably benign Het
Cdhr1 A T 14: 37,094,000 probably null Het
Cfc1 G A 1: 34,537,153 C98Y probably damaging Het
Cyp11b2 A T 15: 74,851,684 probably benign Het
Cyth4 C A 15: 78,615,785 H255Q possibly damaging Het
Dip2a T C 10: 76,321,531 K80R probably benign Het
Dnajb5 G T 4: 42,957,083 D257Y probably damaging Het
Dynll1 T C 5: 115,300,506 probably benign Het
Edn1 T A 13: 42,304,954 V81E probably damaging Het
F5 T C 1: 164,211,763 S1981P probably damaging Het
Fam186b T A 15: 99,280,519 M309L probably benign Het
Gm14221 G A 2: 160,574,677 noncoding transcript Het
Gnptab T A 10: 88,431,466 probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gpr176 A G 2: 118,284,012 C106R probably damaging Het
Hdac7 A T 15: 97,806,679 probably null Het
Hlx T C 1: 184,731,640 S168G probably damaging Het
Hnf1a G T 5: 114,950,688 probably benign Het
Hp1bp3 C T 4: 138,222,161 L19F possibly damaging Het
Hspa14 T A 2: 3,511,049 T63S probably damaging Het
Insrr C T 3: 87,800,872 S207F probably damaging Het
Jak3 C A 8: 71,682,274 probably benign Het
Jmjd7 G A 2: 120,030,341 A91T probably damaging Het
Lgals9 G T 11: 78,965,812 H265Q possibly damaging Het
Lrriq1 T G 10: 103,161,777 N1326H probably damaging Het
Mdn1 C A 4: 32,672,837 Q486K probably benign Het
Mpeg1 A G 19: 12,461,759 T194A probably damaging Het
Nek5 T A 8: 22,088,797 probably benign Het
Pcgf2 A C 11: 97,692,047 I135M probably benign Het
Phactr1 G T 13: 43,059,591 A222S probably benign Het
Pla2r1 T C 2: 60,479,515 S575G probably benign Het
Plcg2 T C 8: 117,614,288 probably null Het
Polg A G 7: 79,460,151 probably benign Het
Poteg T G 8: 27,449,958 L48V possibly damaging Het
Prmt1 A T 7: 44,981,779 C50S probably benign Het
Prx T A 7: 27,518,195 V707E probably damaging Het
Rrp12 C T 19: 41,874,705 probably benign Het
Saxo1 A T 4: 86,445,103 V381E probably damaging Het
Sh2d2a T C 3: 87,847,109 probably null Het
Slc26a5 A C 5: 21,846,345 I57R probably damaging Het
Slc38a3 T A 9: 107,655,213 probably null Het
Slc5a4b T C 10: 76,090,700 T188A probably damaging Het
Slc7a13 A G 4: 19,824,010 I260V probably benign Het
Smg8 A T 11: 87,086,462 S98T probably benign Het
Spg20 T A 3: 55,128,365 S548R probably damaging Het
Sult6b1 C T 17: 78,905,529 G98S probably damaging Het
Tbc1d2 A G 4: 46,649,806 Y77H probably damaging Het
Tet2 T A 3: 133,466,804 D1899V probably damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Uap1l1 T C 2: 25,363,277 E382G probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Ugt1a9 T C 1: 88,071,392 V188A probably damaging Het
Virma T C 4: 11,519,416 probably null Het
Xrcc6 T C 15: 82,022,592 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Zfp804b T A 5: 6,772,014 T350S probably benign Het
Zfp959 G T 17: 55,896,201 R61M probably null Het
Other mutations in Pold3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Pold3 APN 7 100088145 splice site probably benign
IGL02101:Pold3 APN 7 100100496 missense probably damaging 0.99
IGL02402:Pold3 APN 7 100100411 splice site probably benign
IGL02541:Pold3 APN 7 100083672 missense probably damaging 1.00
IGL03145:Pold3 APN 7 100096512 missense probably damaging 1.00
R1263:Pold3 UTSW 7 100119683 missense possibly damaging 0.65
R1956:Pold3 UTSW 7 100088111 missense probably benign 0.03
R2508:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R3933:Pold3 UTSW 7 100121401 missense probably damaging 1.00
R4135:Pold3 UTSW 7 100100647 nonsense probably null
R4354:Pold3 UTSW 7 100100617 missense possibly damaging 0.81
R5038:Pold3 UTSW 7 100121383 missense probably damaging 1.00
R6060:Pold3 UTSW 7 100100612 nonsense probably null
R6118:Pold3 UTSW 7 100096407 missense possibly damaging 0.88
R6338:Pold3 UTSW 7 100088105 missense possibly damaging 0.94
R6466:Pold3 UTSW 7 100100632 missense probably benign 0.01
R7000:Pold3 UTSW 7 100106658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGAAAGTCGGCCAGTCTCAAC -3'
(R):5'- AGCAGAGAAATCGCAACGTTCTCAG -3'

Sequencing Primer
(F):5'- CCAGTCTCAACTGTCTTGAGGG -3'
(R):5'- GCTGGCCTCTCACTAGTTTGG -3'
Posted On2013-06-12