Incidental Mutation 'R4348:Rnf31'
ID328414
Institutional Source Beutler Lab
Gene Symbol Rnf31
Ensembl Gene ENSMUSG00000047098
Gene Namering finger protein 31
SynonymsPaul, HOIP
MMRRC Submission 041103-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4348 (G1)
Quality Score217
Status Not validated
Chromosome14
Chromosomal Location55591708-55603693 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAC to A at 55601098 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000137296] [ENSMUST00000138037]
Predicted Effect probably null
Transcript: ENSMUST00000019443
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably benign
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137296
SMART Domains Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 66 151 6.8e-17 PFAM
Blast:RING 214 257 3e-17 BLAST
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 404 428 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140178
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably benign
Transcript: ENSMUST00000227708
Meta Mutation Damage Score 0.6568 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aass A G 6: 23,113,739 F235L probably benign Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Cngb3 G A 4: 19,396,688 R347Q probably damaging Het
Cntnap4 T A 8: 112,753,922 C334S probably damaging Het
D7Ertd443e ACCTAGGAGGTCCT ACCT 7: 134,348,953 probably null Het
Dnah12 T A 14: 26,814,541 M2138K possibly damaging Het
Ebf2 T C 14: 67,239,422 I138T probably damaging Het
Ect2l A G 10: 18,136,988 S784P probably damaging Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Fam160a2 A G 7: 105,385,349 V422A probably damaging Het
Garem2 G A 5: 30,105,368 R26H possibly damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
Kcns3 T C 12: 11,091,381 N439S possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mbd1 G T 18: 74,274,416 R199L probably damaging Het
Mbd5 T A 2: 49,256,327 M183K probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ntrk2 A G 13: 58,878,259 K464E probably damaging Het
Orc1 C T 4: 108,593,452 T127I probably damaging Het
Pcdh17 T C 14: 84,447,620 I509T probably damaging Het
Pcsk7 G A 9: 45,919,348 A475T probably damaging Het
Prdm16 A G 4: 154,476,667 V136A probably benign Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptpn13 T A 5: 103,569,726 S1879R probably damaging Het
Rasgrp3 A T 17: 75,511,980 Q388L probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Smco3 T A 6: 136,831,694 T61S possibly damaging Het
Ssx2ip T C 3: 146,432,490 V364A probably benign Het
Ttn A G 2: 76,764,765 I20347T possibly damaging Het
Vmn2r120 A T 17: 57,522,466 F477Y possibly damaging Het
Wee1 A G 7: 110,130,958 H423R probably damaging Het
Other mutations in Rnf31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf31 APN 14 55592319 splice site probably null
IGL01532:Rnf31 APN 14 55602623 missense probably damaging 0.99
IGL02118:Rnf31 APN 14 55599112 missense probably damaging 1.00
IGL02272:Rnf31 APN 14 55598782 missense probably damaging 1.00
IGL02893:Rnf31 APN 14 55599109 missense probably damaging 1.00
IGL02939:Rnf31 APN 14 55595674 missense probably benign 0.30
R0285:Rnf31 UTSW 14 55601389 missense probably damaging 0.96
R0678:Rnf31 UTSW 14 55601713 nonsense probably null
R0924:Rnf31 UTSW 14 55593002 unclassified probably benign
R1386:Rnf31 UTSW 14 55596764 missense probably damaging 1.00
R1507:Rnf31 UTSW 14 55598982 nonsense probably null
R2122:Rnf31 UTSW 14 55596197 missense probably damaging 1.00
R2164:Rnf31 UTSW 14 55592537 missense possibly damaging 0.90
R3714:Rnf31 UTSW 14 55603394 missense probably damaging 1.00
R3921:Rnf31 UTSW 14 55601142 missense probably damaging 1.00
R4349:Rnf31 UTSW 14 55601098 frame shift probably null
R4350:Rnf31 UTSW 14 55601098 frame shift probably null
R4351:Rnf31 UTSW 14 55601098 frame shift probably null
R4353:Rnf31 UTSW 14 55601098 frame shift probably null
R4472:Rnf31 UTSW 14 55603320 missense probably damaging 1.00
R5004:Rnf31 UTSW 14 55592182 missense probably damaging 1.00
R5245:Rnf31 UTSW 14 55601706 missense probably damaging 1.00
R5286:Rnf31 UTSW 14 55592236 missense probably damaging 1.00
R5669:Rnf31 UTSW 14 55596704 missense probably damaging 1.00
R5750:Rnf31 UTSW 14 55598686 missense probably damaging 1.00
R6377:Rnf31 UTSW 14 55595527 missense probably damaging 1.00
R7009:Rnf31 UTSW 14 55592551 missense probably benign 0.00
R7018:Rnf31 UTSW 14 55592233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTGGCCCTCAGTTTTAG -3'
(R):5'- GAACTTGCATTTCGGACAGTCTG -3'

Sequencing Primer
(F):5'- GGCCCTCAGTTTTAGGATCTAAG -3'
(R):5'- GCATTTCGGACAGTCTGTGAAG -3'
Posted On2015-07-07