Incidental Mutation 'R6362:Mfsd4b2'
ID512525
Institutional Source Beutler Lab
Gene Symbol Mfsd4b2
Ensembl Gene ENSMUSG00000039339
Gene Namemajor facilitator superfamily domain containing 4B2
Synonyms2010001E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6362 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39920382-39926923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39921609 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 250 (I250N)
Ref Sequence ENSEMBL: ENSMUSP00000040384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045526]
Predicted Effect probably damaging
Transcript: ENSMUST00000045526
AA Change: I250N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040384
Gene: ENSMUSG00000039339
AA Change: I250N

DomainStartEndE-ValueType
Pfam:MFS_1 1 322 3.9e-11 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T G 2: 173,528,174 probably null Het
Aldh5a1 T G 13: 24,918,550 D310A probably benign Het
Als2cl T A 9: 110,895,446 probably null Het
Amacr C A 15: 10,984,805 R170S probably damaging Het
Brwd1 C T 16: 96,002,307 R2221Q probably damaging Het
Cacna1g A T 11: 94,439,707 probably null Het
Cd3d G A 9: 44,986,291 D157N probably damaging Het
Cep131 T C 11: 120,064,690 D1043G probably damaging Het
Cit A G 5: 115,886,676 D326G probably benign Het
Col16a1 G C 4: 130,066,190 G370R unknown Het
Col6a3 T A 1: 90,810,563 Y1078F probably damaging Het
Colgalt2 A C 1: 152,471,798 Y161S probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Daxx G A 17: 33,911,364 V118I probably damaging Het
Dennd5a G T 7: 109,934,265 C75* probably null Het
Diaph3 A G 14: 86,772,130 L1071P probably damaging Het
Disp3 A G 4: 148,254,308 L802P possibly damaging Het
Dmc1 A G 15: 79,588,823 V141A probably benign Het
Dsc2 A T 18: 20,035,463 Y45* probably null Het
Dspp A G 5: 104,176,034 I348V probably benign Het
Epb42 C A 2: 121,025,779 C428F possibly damaging Het
Fam227a G T 15: 79,643,350 P100Q possibly damaging Het
Fer1l4 C T 2: 156,048,250 V252I probably benign Het
Fhod1 C A 8: 105,331,641 probably null Het
Fhod3 G T 18: 24,754,255 A68S probably benign Het
Gatm T C 2: 122,598,196 D328G probably benign Het
Gm13103 A G 4: 143,852,865 Y340C probably damaging Het
Gm6401 G T 14: 41,967,770 H44N probably benign Het
Gm884 G C 11: 103,620,652 N163K unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr84 G A 15: 103,308,510 A380V probably damaging Het
Herc1 G T 9: 66,471,908 W3492L probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Jag2 T A 12: 112,920,122 K246N probably damaging Het
Klhl32 T C 4: 24,629,195 D524G probably null Het
Lax1 A G 1: 133,680,596 S136P possibly damaging Het
Lefty1 A G 1: 180,937,160 K217E probably benign Het
Lgr5 A G 10: 115,478,525 L169P probably damaging Het
Mad1l1 A T 5: 140,315,055 S29T possibly damaging Het
Man1a T C 10: 54,074,795 H77R probably benign Het
Met C T 6: 17,558,733 S1120F probably damaging Het
Myod1 A G 7: 46,376,881 H70R possibly damaging Het
Neb T C 2: 52,212,692 N4280S probably benign Het
Nudt6 T C 3: 37,419,489 T28A possibly damaging Het
Nup85 A G 11: 115,583,734 E628G probably damaging Het
Oaz3 A T 3: 94,434,988 D120E probably damaging Het
Olfr1031 C A 2: 85,991,941 N41K probably damaging Het
Olfr1105 C T 2: 87,033,289 A311T probably benign Het
Olfr131 A T 17: 38,082,729 M83K probably damaging Het
Olfr1454 A T 19: 13,063,345 probably benign Het
Olfr786 A C 10: 129,436,943 I44L probably damaging Het
Osbpl8 A T 10: 111,273,068 K404* probably null Het
Pcdhga2 A G 18: 37,670,905 N601D probably damaging Het
Pld2 T C 11: 70,554,675 Y638H probably damaging Het
Prickle2 C G 6: 92,458,615 V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 R125C probably benign Het
Rnaset2b G A 17: 6,991,694 V24I probably benign Het
Rusc2 A T 4: 43,416,416 D574V probably benign Het
Scn8a T A 15: 100,940,115 probably null Het
Sec11a T C 7: 80,923,131 E134G probably benign Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Shkbp1 C T 7: 27,351,695 probably null Het
Slc43a1 T C 2: 84,859,784 L435P probably damaging Het
Spn G A 7: 127,136,723 P204L possibly damaging Het
Srr T A 11: 74,910,202 Q173L probably damaging Het
Star C G 8: 25,811,807 T222S probably benign Het
Timm22 T A 11: 76,411,127 Y93N probably damaging Het
Tmc4 G T 7: 3,675,459 Q58K probably benign Het
Tmem86b C T 7: 4,629,836 M1I probably null Het
Tmtc2 A T 10: 105,369,970 I488N probably damaging Het
Tnxb A T 17: 34,694,388 Y1792F probably damaging Het
Tph1 T A 7: 46,647,443 R443W possibly damaging Het
Ttyh1 T A 7: 4,129,324 V253E possibly damaging Het
Usf3 A G 16: 44,218,577 D1140G probably benign Het
Usp10 T C 8: 119,941,316 S118P probably benign Het
Vmn2r63 C T 7: 42,903,297 C845Y probably benign Het
Vmn2r72 G T 7: 85,751,174 F222L probably damaging Het
Zfp654 G A 16: 64,786,094 Q582* probably null Het
Zfp791 C T 8: 85,119,650 probably benign Het
Zfp879 T A 11: 50,838,475 D32V probably damaging Het
Other mutations in Mfsd4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Mfsd4b2 APN 10 39925061 splice site probably benign
IGL01546:Mfsd4b2 APN 10 39921475 missense probably damaging 1.00
IGL01662:Mfsd4b2 APN 10 39922197 splice site probably benign
IGL02151:Mfsd4b2 APN 10 39921691 missense probably damaging 1.00
R1928:Mfsd4b2 UTSW 10 39921462 missense probably damaging 1.00
R2851:Mfsd4b2 UTSW 10 39922123 missense probably benign 0.07
R3777:Mfsd4b2 UTSW 10 39921531 missense possibly damaging 0.54
R5055:Mfsd4b2 UTSW 10 39923777 missense possibly damaging 0.79
R5257:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5258:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5563:Mfsd4b2 UTSW 10 39922042 missense probably benign 0.15
R5728:Mfsd4b2 UTSW 10 39923795 missense possibly damaging 0.47
R5888:Mfsd4b2 UTSW 10 39922035 missense probably benign 0.00
R6147:Mfsd4b2 UTSW 10 39921577 missense probably benign
R7462:Mfsd4b2 UTSW 10 39921881 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTGCAGATTTCCCAGTTAAGG -3'
(R):5'- AGGGCTAAATATCACAGGGCCC -3'

Sequencing Primer
(F):5'- AGGTAGTGTACTGCTCAATCCAG -3'
(R):5'- GGCCCTGCTATGCCTCC -3'
Posted On2018-04-27