Incidental Mutation 'R6396:Olfr1225'
ID515994
Institutional Source Beutler Lab
Gene Symbol Olfr1225
Ensembl Gene ENSMUSG00000101918
Gene Nameolfactory receptor 1225
SynonymsMOR233-11, GA_x6K02T2Q125-50650037-50649102
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6396 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89168380-89174669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89170690 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 174 (D174A)
Ref Sequence ENSEMBL: ENSMUSP00000150915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188861] [ENSMUST00000216961] [ENSMUST00000217054]
Predicted Effect probably damaging
Transcript: ENSMUST00000188861
AA Change: D174A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140442
Gene: ENSMUSG00000101918
AA Change: D174A

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
Pfam:7tm_1 39 289 5.5e-24 PFAM
Pfam:7tm_4 138 287 2.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216961
AA Change: D174A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217054
AA Change: D174A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,327,919 D821G probably damaging Het
Arhgap35 A T 7: 16,562,299 I947K probably damaging Het
B3galnt2 A T 13: 13,995,748 I447F probably damaging Het
Cacna2d3 C A 14: 29,396,565 V134L probably benign Het
Clcn4 C T 7: 7,294,025 G145S probably damaging Het
Cndp1 A T 18: 84,632,010 M186K probably benign Het
Cntn6 A G 6: 104,650,500 Y98C probably damaging Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dyrk1a C A 16: 94,671,440 Q230K probably damaging Het
Ech1 C T 7: 28,830,338 probably null Het
Fam81b T A 13: 76,251,849 R97W probably damaging Het
Heatr1 A G 13: 12,406,097 E423G possibly damaging Het
Hydin A T 8: 110,506,889 K1786N probably damaging Het
Igf2r T C 17: 12,714,090 I848M probably benign Het
Igkv10-96 G A 6: 68,631,985 Q109* probably null Het
Mup6 T C 4: 60,004,837 I76T possibly damaging Het
Nmt2 A G 2: 3,314,701 R243G probably benign Het
Nsd1 G A 13: 55,238,789 G119D probably damaging Het
Olfr1218 A G 2: 89,055,297 I43T probably benign Het
Olfr51 A G 11: 51,007,485 H171R possibly damaging Het
Olfr613 C T 7: 103,552,681 Q299* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank3 T C 11: 35,778,689 V250A probably damaging Het
Pcdh10 A G 3: 45,380,060 I270V possibly damaging Het
Pnp2 T A 14: 50,963,159 V94E probably damaging Het
Prdm10 T C 9: 31,318,546 V86A possibly damaging Het
Riox1 G A 12: 83,951,313 D208N possibly damaging Het
Rrp15 A G 1: 186,737,586 probably null Het
Skor1 G T 9: 63,144,950 P579Q probably damaging Het
Slc44a4 T A 17: 34,928,884 Y481* probably null Het
Smg7 A T 1: 152,848,600 V610E probably benign Het
Tlx1 A G 19: 45,156,052 Q71R probably damaging Het
Vmn2r27 A T 6: 124,224,166 Y277* probably null Het
Zswim2 T A 2: 83,923,718 R199S probably damaging Het
Other mutations in Olfr1225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Olfr1225 APN 2 89171089 missense possibly damaging 0.53
IGL03381:Olfr1225 APN 2 89171179 missense possibly damaging 0.49
IGL03147:Olfr1225 UTSW 2 89170972 missense probably benign 0.03
R0100:Olfr1225 UTSW 2 89171087 missense probably benign 0.00
R0373:Olfr1225 UTSW 2 89170413 missense probably benign 0.02
R0482:Olfr1225 UTSW 2 89170631 missense probably benign 0.37
R0491:Olfr1225 UTSW 2 89170360 missense probably benign 0.07
R0548:Olfr1225 UTSW 2 89170648 missense probably damaging 1.00
R1123:Olfr1225 UTSW 2 89170868 missense possibly damaging 0.89
R1511:Olfr1225 UTSW 2 89170937 missense probably damaging 1.00
R1565:Olfr1225 UTSW 2 89170627 missense probably benign 0.01
R4204:Olfr1225 UTSW 2 89170780 missense probably benign 0.13
R4580:Olfr1225 UTSW 2 89171200 missense probably benign 0.01
R4669:Olfr1225 UTSW 2 89170901 missense probably damaging 1.00
R5137:Olfr1225 UTSW 2 89170400 missense probably benign 0.00
R6391:Olfr1225 UTSW 2 89170598 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGAGGGCTTTAAATTTCCCTTCAG -3'
(R):5'- GCACTTCTTCACTGGGATGG -3'

Sequencing Primer
(F):5'- AAATTTCCCTTCAGAGCTGTGG -3'
(R):5'- ATAGTACTGTCAGCCATGGC -3'
Posted On2018-05-04