Incidental Mutation 'R6468:Fam83f'
ID516447
Institutional Source Beutler Lab
Gene Symbol Fam83f
Ensembl Gene ENSMUSG00000022408
Gene Namefamily with sequence similarity 83, member F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6468 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80671847-80700425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80692111 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 321 (Y321C)
Ref Sequence ENSEMBL: ENSMUSP00000023044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023044
AA Change: Y321C

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023044
Gene: ENSMUSG00000022408
AA Change: Y321C

DomainStartEndE-ValueType
Pfam:DUF1669 15 291 1.5e-111 PFAM
Pfam:PLDc_2 148 286 6.4e-12 PFAM
low complexity region 346 360 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230612
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Chd6 A G 2: 161,013,067 M807T probably damaging Het
Cpxm2 T C 7: 132,070,860 D320G probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Depdc5 A G 5: 32,912,231 N437S probably benign Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gak G T 5: 108,623,336 C102* probably null Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Mgst1 A G 6: 138,141,587 probably null Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr733 A T 14: 50,298,467 L281I probably benign Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Fam83f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Fam83f APN 15 80672149 missense probably benign
R0212:Fam83f UTSW 15 80690578 missense probably benign 0.00
R0347:Fam83f UTSW 15 80672257 missense probably damaging 1.00
R0976:Fam83f UTSW 15 80692084 missense probably damaging 1.00
R1724:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1725:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1741:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1796:Fam83f UTSW 15 80690082 missense possibly damaging 0.80
R1870:Fam83f UTSW 15 80689912 splice site probably benign
R1899:Fam83f UTSW 15 80692080 missense probably damaging 1.00
R2022:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R2114:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R2115:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R4090:Fam83f UTSW 15 80692192 missense possibly damaging 0.85
R4865:Fam83f UTSW 15 80692449 missense probably damaging 1.00
R4893:Fam83f UTSW 15 80691955 missense probably damaging 1.00
R5206:Fam83f UTSW 15 80692054 missense possibly damaging 0.86
R5739:Fam83f UTSW 15 80692005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTATGTGGACAGGAATC -3'
(R):5'- AGGTCTCTGCAATCTTGGGG -3'

Sequencing Primer
(F):5'- CCTATGTGGACAGGAATCTCCTC -3'
(R):5'- TCCACAGTGGGCAATATCTG -3'
Posted On2018-05-21