Incidental Mutation 'R6485:Arhgap33'
ID517296
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene NameRho GTPase activating protein 33
SynonymsSnx26, NOMA-GAP, Tcgap
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6485 (G1)
Quality Score147.008
Status Not validated
Chromosome7
Chromosomal Location30522226-30535060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30524004 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 867 (T867A)
Ref Sequence ENSEMBL: ENSMUSP00000146767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208522] [ENSMUST00000208538]
Predicted Effect probably benign
Transcript: ENSMUST00000044338
AA Change: T867A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882
AA Change: T867A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207637
Predicted Effect probably benign
Transcript: ENSMUST00000207858
AA Change: T843A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207860
AA Change: T867A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208522
Predicted Effect probably benign
Transcript: ENSMUST00000208538
AA Change: T867A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Col6a4 A G 9: 106,076,870 probably null Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Arhgap33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Arhgap33 APN 7 30529946 missense probably damaging 0.99
IGL02176:Arhgap33 APN 7 30524051 missense possibly damaging 0.76
IGL02430:Arhgap33 APN 7 30522760 missense probably benign 0.07
IGL03091:Arhgap33 APN 7 30528293 missense probably damaging 1.00
R0276:Arhgap33 UTSW 7 30523244 missense probably benign 0.01
R0494:Arhgap33 UTSW 7 30524496 missense probably damaging 0.98
R0597:Arhgap33 UTSW 7 30526446 missense probably damaging 1.00
R0717:Arhgap33 UTSW 7 30528349 missense probably damaging 1.00
R1661:Arhgap33 UTSW 7 30532323 missense probably damaging 1.00
R1761:Arhgap33 UTSW 7 30533063 intron probably null
R1882:Arhgap33 UTSW 7 30522809 missense probably damaging 1.00
R2161:Arhgap33 UTSW 7 30528650 splice site probably null
R2566:Arhgap33 UTSW 7 30527229 missense probably damaging 1.00
R4353:Arhgap33 UTSW 7 30524136 missense possibly damaging 0.95
R4552:Arhgap33 UTSW 7 30519108 unclassified probably benign
R4778:Arhgap33 UTSW 7 30532093 missense probably benign
R4887:Arhgap33 UTSW 7 30532192 missense probably damaging 0.99
R4957:Arhgap33 UTSW 7 30532361 missense probably damaging 0.96
R5001:Arhgap33 UTSW 7 30533016 missense possibly damaging 0.95
R5140:Arhgap33 UTSW 7 30528301 missense probably damaging 1.00
R5585:Arhgap33 UTSW 7 30523835 missense probably benign 0.00
R5704:Arhgap33 UTSW 7 30519620 unclassified probably benign
R5805:Arhgap33 UTSW 7 30526414 missense probably benign 0.01
R6476:Arhgap33 UTSW 7 30524412 missense probably damaging 0.99
R6572:Arhgap33 UTSW 7 30527210 missense probably damaging 1.00
R7183:Arhgap33 UTSW 7 30525871 intron probably null
R7205:Arhgap33 UTSW 7 30533009 missense probably damaging 0.99
R7241:Arhgap33 UTSW 7 30528721 missense probably damaging 1.00
R7259:Arhgap33 UTSW 7 30532200 missense probably damaging 1.00
R7319:Arhgap33 UTSW 7 30526369 missense probably benign
R7384:Arhgap33 UTSW 7 30527271 missense probably damaging 1.00
X0034:Arhgap33 UTSW 7 30524449 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TAACGGTGAATCCATGCCGC -3'
(R):5'- TTACCTTTCGCTGCAGCAG -3'

Sequencing Primer
(F):5'- TGAATCCATGCCGCCAGGAC -3'
(R):5'- ATGGACCCACTAAGCCTGCTTC -3'
Posted On2018-05-21