Mutagenetix > Incidental Mutation

Incidental Mutation 'R6424:Smarcd1'

518273

Institutional Source

Beutler Lab

Gene Symbol

Smarcd1

Ensembl Gene

ENSMUSG00000023018

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1

Synonyms

D15Kz1, Baf60a

MMRRC Submission

044387-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R6424 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99600175-99611872 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99602248 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 128 (F128L)

Ref Sequence

ENSEMBL: ENSMUSP00000155619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000023759] [ENSMUST00000163472] [ENSMUST00000228984] [ENSMUST00000229236] [ENSMUST00000230530] [ENSMUST00000229845]

AlphaFold

Q61466

Predicted Effect

probably benign
Transcript: ENSMUST00000023758

SMART Domains

Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

Domain	Start	End	E-Value	Type
Pfam:ASC	21	454	9.9e-95	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000023759
AA Change: F190L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018
AA Change: F190L

Domain	Start	End	E-Value	Type
low complexity region	9	38	N/A	INTRINSIC
low complexity region	103	117	N/A	INTRINSIC
Blast:KISc	124	271	2e-43	BLAST
SWIB	291	370	1.97e-35	SMART
Blast:MYSc	452	498	2e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000163472

SMART Domains

Protein: ENSMUSP00000128823
Gene: ENSMUSG00000091604

Domain	Start	End	E-Value	Type
low complexity region	18	42	N/A	INTRINSIC
low complexity region	44	78	N/A	INTRINSIC
low complexity region	85	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227670

Predicted Effect

probably benign
Transcript: ENSMUST00000228984

Predicted Effect

probably benign
Transcript: ENSMUST00000229236

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229686

Predicted Effect

probably damaging
Transcript: ENSMUST00000230530
AA Change: F128L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230748

Predicted Effect

probably benign
Transcript: ENSMUST00000229845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229968

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230504

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,460,542 (GRCm39)	V4184A	probably benign	Het
Acvr2b	T	A	9: 119,231,645 (GRCm39)	W12R	probably benign	Het
Arap2	T	C	5: 62,840,707 (GRCm39)	K720E	probably damaging	Het
Cr1l	A	C	1: 194,800,123 (GRCm39)	F184V	probably damaging	Het
Haus8	C	T	8: 71,704,080 (GRCm39)	W359*	probably null	Het
Insm2	A	T	12: 55,646,867 (GRCm39)	I204F	probably damaging	Het
Katnb1	T	A	8: 95,820,144 (GRCm39)	I97N	probably damaging	Het
Kif1b	T	C	4: 149,277,053 (GRCm39)	M1337V	probably benign	Het
Map2	A	T	1: 66,453,946 (GRCm39)	K945N	possibly damaging	Het
Meltf	T	A	16: 31,699,080 (GRCm39)	C63*	probably null	Het
Nbas	T	C	12: 13,465,734 (GRCm39)		probably null	Het
Or5p1	G	A	7: 107,916,412 (GRCm39)	V104I	probably benign	Het
Raf1	T	C	6: 115,596,542 (GRCm39)	E594G	probably benign	Het
Rsrc1	C	T	3: 66,901,982 (GRCm39)	P44L	unknown	Het
Scgb2b19	A	C	7: 32,978,022 (GRCm39)	S92A	possibly damaging	Het
Serpinb3c	T	A	1: 107,199,359 (GRCm39)	*387Y	probably null	Het
Shpk	A	T	11: 73,104,318 (GRCm39)	I156F	possibly damaging	Het
Tars3	G	A	7: 65,305,487 (GRCm39)	G237E	probably damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,650,884 (GRCm39)		probably null	Het
Ttn	T	C	2: 76,719,848 (GRCm39)		probably benign	Het
Vmn1r223	T	A	13: 23,434,345 (GRCm39)	I313N	probably damaging	Het

Other mutations in Smarcd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01516:Smarcd1	APN	15	99,610,094 (GRCm39)	missense	probably benign	0.10
IGL01714:Smarcd1	APN	15	99,610,302 (GRCm39)	missense	probably damaging	1.00
IGL02488:Smarcd1	APN	15	99,609,082 (GRCm39)	missense	possibly damaging	0.83
P0021:Smarcd1	UTSW	15	99,610,242 (GRCm39)	splice site	probably benign
R0597:Smarcd1	UTSW	15	99,608,975 (GRCm39)	missense	probably damaging	1.00
R0645:Smarcd1	UTSW	15	99,605,267 (GRCm39)	splice site	probably null
R1531:Smarcd1	UTSW	15	99,605,264 (GRCm39)	missense	probably damaging	1.00
R1661:Smarcd1	UTSW	15	99,605,519 (GRCm39)	critical splice acceptor site	probably null
R1857:Smarcd1	UTSW	15	99,607,295 (GRCm39)	missense	probably damaging	0.97
R3003:Smarcd1	UTSW	15	99,610,065 (GRCm39)	missense	probably damaging	1.00
R4170:Smarcd1	UTSW	15	99,605,812 (GRCm39)	missense	probably damaging	1.00
R4964:Smarcd1	UTSW	15	99,605,862 (GRCm39)	missense	possibly damaging	0.79
R5116:Smarcd1	UTSW	15	99,600,369 (GRCm39)	missense	probably benign	0.00
R5358:Smarcd1	UTSW	15	99,601,128 (GRCm39)	nonsense	probably null
R5559:Smarcd1	UTSW	15	99,601,176 (GRCm39)	critical splice donor site	probably null
R6026:Smarcd1	UTSW	15	99,603,619 (GRCm39)	missense	probably damaging	1.00
R6450:Smarcd1	UTSW	15	99,605,766 (GRCm39)	missense	possibly damaging	0.85
R7126:Smarcd1	UTSW	15	99,607,206 (GRCm39)	missense	probably damaging	1.00
R8476:Smarcd1	UTSW	15	99,600,305 (GRCm39)	missense	probably damaging	0.99
R8487:Smarcd1	UTSW	15	99,605,657 (GRCm39)	missense	probably damaging	0.96
R8872:Smarcd1	UTSW	15	99,608,975 (GRCm39)	missense	probably damaging	1.00
X0026:Smarcd1	UTSW	15	99,600,330 (GRCm39)	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- AGGTCGGGACTGTACACTTC -3'
(R):5'- TGTATGCAGGGAACACAGCC -3'

Sequencing Primer
(F):5'- TCCGAGTGGAGTCTCTGTCC -3'
(R):5'- AGGTTTCCTGCTGAGCACAC -3'

Posted On

2018-05-24