Incidental Mutation 'R6424:Smarcd1'
ID518273
Institutional Source Beutler Lab
Gene Symbol Smarcd1
Ensembl Gene ENSMUSG00000023018
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
SynonymsD15Kz1, Baf60a
MMRRC Submission 044387-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R6424 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99702129-99713991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99704367 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 128 (F128L)
Ref Sequence ENSEMBL: ENSMUSP00000155619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000023759] [ENSMUST00000163472] [ENSMUST00000228984] [ENSMUST00000229236] [ENSMUST00000229845] [ENSMUST00000230530]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000023759
AA Change: F190L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018
AA Change: F190L

DomainStartEndE-ValueType
low complexity region 9 38 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Blast:KISc 124 271 2e-43 BLAST
SWIB 291 370 1.97e-35 SMART
Blast:MYSc 452 498 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163472
SMART Domains Protein: ENSMUSP00000128823
Gene: ENSMUSG00000091604

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
low complexity region 44 78 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect probably benign
Transcript: ENSMUST00000228984
Predicted Effect probably benign
Transcript: ENSMUST00000229236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229686
Predicted Effect probably benign
Transcript: ENSMUST00000229845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230504
Predicted Effect probably damaging
Transcript: ENSMUST00000230530
AA Change: F128L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230748
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,510,542 V4184A probably benign Het
Acvr2b T A 9: 119,402,579 W12R probably benign Het
Arap2 T C 5: 62,683,364 K720E probably damaging Het
Cr1l A C 1: 195,117,815 F184V probably damaging Het
Haus8 C T 8: 71,251,436 W359* probably null Het
Insm2 A T 12: 55,600,082 I204F probably damaging Het
Katnb1 T A 8: 95,093,516 I97N probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map2 A T 1: 66,414,787 K945N possibly damaging Het
Meltf T A 16: 31,880,262 C63* probably null Het
Nbas T C 12: 13,415,733 probably null Het
Olfr491 G A 7: 108,317,205 V104I probably benign Het
Raf1 T C 6: 115,619,581 E594G probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scgb2b19 A C 7: 33,278,597 S92A possibly damaging Het
Serpinb3c T A 1: 107,271,629 *387Y probably null Het
Shpk A T 11: 73,213,492 I156F possibly damaging Het
Tarsl2 G A 7: 65,655,739 G237E probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Ttn T C 2: 76,889,504 probably benign Het
Vmn1r223 T A 13: 23,250,175 I313N probably damaging Het
Other mutations in Smarcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Smarcd1 APN 15 99712213 missense probably benign 0.10
IGL01714:Smarcd1 APN 15 99712421 missense probably damaging 1.00
IGL02488:Smarcd1 APN 15 99711201 missense possibly damaging 0.83
P0021:Smarcd1 UTSW 15 99712361 splice site probably benign
R0597:Smarcd1 UTSW 15 99711094 missense probably damaging 1.00
R0645:Smarcd1 UTSW 15 99707386 unclassified probably null
R1531:Smarcd1 UTSW 15 99707383 missense probably damaging 1.00
R1661:Smarcd1 UTSW 15 99707638 critical splice acceptor site probably null
R1857:Smarcd1 UTSW 15 99709414 missense probably damaging 0.97
R3003:Smarcd1 UTSW 15 99712184 missense probably damaging 1.00
R4170:Smarcd1 UTSW 15 99707931 missense probably damaging 1.00
R4964:Smarcd1 UTSW 15 99707981 missense possibly damaging 0.79
R5116:Smarcd1 UTSW 15 99702488 missense probably benign 0.00
R5358:Smarcd1 UTSW 15 99703247 nonsense probably null
R5559:Smarcd1 UTSW 15 99703295 critical splice donor site probably null
R6026:Smarcd1 UTSW 15 99705738 missense probably damaging 1.00
R6450:Smarcd1 UTSW 15 99707885 missense possibly damaging 0.85
R7126:Smarcd1 UTSW 15 99709325 missense probably damaging 1.00
X0026:Smarcd1 UTSW 15 99702449 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGTCGGGACTGTACACTTC -3'
(R):5'- TGTATGCAGGGAACACAGCC -3'

Sequencing Primer
(F):5'- TCCGAGTGGAGTCTCTGTCC -3'
(R):5'- AGGTTTCCTGCTGAGCACAC -3'
Posted On2018-05-24