Incidental Mutation 'R6442:Sapcd2'
ID519040
Institutional Source Beutler Lab
Gene Symbol Sapcd2
Ensembl Gene ENSMUSG00000026955
Gene Namesuppressor APC domain containing 2
Synonyms6030458L21Rik, ang, 2010317E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25372321-25378213 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 25376122 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028329] [ENSMUST00000100323] [ENSMUST00000114293]
Predicted Effect probably benign
Transcript: ENSMUST00000028329
SMART Domains Protein: ENSMUSP00000028329
Gene: ENSMUSG00000026955

DomainStartEndE-ValueType
low complexity region 197 212 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
Pfam:Suppressor_APC 257 340 1.6e-34 PFAM
low complexity region 348 362 N/A INTRINSIC
coiled coil region 374 415 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000100323
AA Change: M328K
SMART Domains Protein: ENSMUSP00000097898
Gene: ENSMUSG00000026955
AA Change: M328K

DomainStartEndE-ValueType
low complexity region 202 216 N/A INTRINSIC
Pfam:Suppressor_APC 224 305 2.2e-32 PFAM
low complexity region 385 392 N/A INTRINSIC
coiled coil region 403 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114293
SMART Domains Protein: ENSMUSP00000109932
Gene: ENSMUSG00000026955

DomainStartEndE-ValueType
low complexity region 202 216 N/A INTRINSIC
Pfam:Suppressor_APC 223 306 1.4e-34 PFAM
low complexity region 314 328 N/A INTRINSIC
coiled coil region 340 381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155310
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Sapcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Sapcd2 APN 2 25376479 makesense probably null
R1596:Sapcd2 UTSW 2 25376410 missense probably damaging 1.00
R3815:Sapcd2 UTSW 2 25373506 intron probably benign
R4826:Sapcd2 UTSW 2 25372756 missense probably benign 0.09
R4926:Sapcd2 UTSW 2 25373566 intron probably null
R6794:Sapcd2 UTSW 2 25376367 missense probably damaging 1.00
R7090:Sapcd2 UTSW 2 25376079 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACAGGTGTGCCAGGTTC -3'
(R):5'- TGCTTGATGAGTGCAGACTTC -3'

Sequencing Primer
(F):5'- AGGTTCCGGGACTTCCTCATG -3'
(R):5'- TATCAGTCACCTCCTGGGCAG -3'
Posted On2018-05-24