Incidental Mutation 'R6442:Nr1h5'
ID519047
Institutional Source Beutler Lab
Gene Symbol Nr1h5
Ensembl Gene ENSMUSG00000048938
Gene Namenuclear receptor subfamily 1, group H, member 5
SynonymsFXRB
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_198658.2, NM_201619.2, NM_201622.2

Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location102939658-102964133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102941111 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 418 (P418L)
Ref Sequence ENSEMBL: ENSMUSP00000142799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058899] [ENSMUST00000196135] [ENSMUST00000196983] [ENSMUST00000197412] [ENSMUST00000198472]
Predicted Effect probably damaging
Transcript: ENSMUST00000058899
AA Change: P426L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052557
Gene: ENSMUSG00000048938
AA Change: P426L

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 474 1.74e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196135
AA Change: P368L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143445
Gene: ENSMUSG00000048938
AA Change: P368L

DomainStartEndE-ValueType
ZnF_C4 78 132 1.17e-7 SMART
HOLI 231 416 1.74e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196983
AA Change: P418L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142799
Gene: ENSMUSG00000048938
AA Change: P418L

DomainStartEndE-ValueType
Blast:HOLI 2 47 5e-9 BLAST
ZnF_C4 119 190 2.51e-36 SMART
HOLI 289 466 1.76e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197412
SMART Domains Protein: ENSMUSP00000143764
Gene: ENSMUSG00000048938

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 274 362 6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198472
SMART Domains Protein: ENSMUSP00000142345
Gene: ENSMUSG00000048938

DomainStartEndE-ValueType
Blast:HOLI 2 47 4e-9 BLAST
ZnF_C4 119 190 1e-38 SMART
Pfam:Hormone_recep 273 367 5.8e-6 PFAM
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Nr1h5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01829:Nr1h5 APN 3 102949079 missense probably benign 0.02
IGL02021:Nr1h5 APN 3 102947742 intron probably benign
IGL02025:Nr1h5 APN 3 102949626 splice site probably benign
IGL02094:Nr1h5 APN 3 102952196 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R0035:Nr1h5 UTSW 3 102949573 nonsense probably null
R1200:Nr1h5 UTSW 3 102947862 missense probably damaging 1.00
R1977:Nr1h5 UTSW 3 102947817 missense probably damaging 1.00
R4173:Nr1h5 UTSW 3 102952230 missense probably damaging 1.00
R4556:Nr1h5 UTSW 3 102946141 missense probably benign 0.28
R5018:Nr1h5 UTSW 3 102947795 missense probably damaging 1.00
R5471:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
R5617:Nr1h5 UTSW 3 102947829 missense probably damaging 1.00
R5822:Nr1h5 UTSW 3 102949328 missense probably damaging 1.00
R6243:Nr1h5 UTSW 3 102949064 missense probably benign 0.00
R6754:Nr1h5 UTSW 3 102949597 missense probably damaging 1.00
R6789:Nr1h5 UTSW 3 102958361 missense possibly damaging 0.81
R7235:Nr1h5 UTSW 3 102949042 critical splice donor site probably null
R7294:Nr1h5 UTSW 3 102945262 missense probably benign 0.00
X0061:Nr1h5 UTSW 3 102945248 splice site probably null
X0067:Nr1h5 UTSW 3 102949126 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCGAAGGATTTCAGAGTGGC -3'
(R):5'- TATGGCTGTTATATCCCCAACC -3'

Sequencing Primer
(F):5'- CTGTGACTCAGAGTTCTCAGTTCAG -3'
(R):5'- CCTACATTTCAGGGAGCTAATCTG -3'
Posted On2018-05-24