Incidental Mutation 'R6492:Olfr221'
ID523008
Institutional Source Beutler Lab
Gene Symbol Olfr221
Ensembl Gene ENSMUSG00000044286
Gene Nameolfactory receptor 221
SynonymsOlfr1514, GA_x6K02T2RJGY-959918-960853, MOR205-1, MOR205-2, GA_x6K02SYYB8M-929-258
MMRRC Submission
Accession Numbers

Genbank: NM_001001808

Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6492 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52033962-52042459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52035445 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 222 (F222S)
Ref Sequence ENSEMBL: ENSMUSP00000151163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052560] [ENSMUST00000214071] [ENSMUST00000214342] [ENSMUST00000216188] [ENSMUST00000216907]
Predicted Effect probably benign
Transcript: ENSMUST00000052560
AA Change: F222S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063109
Gene: ENSMUSG00000044286
AA Change: F222S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-51 PFAM
Pfam:7tm_1 41 290 3.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214071
AA Change: F222S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214342
AA Change: F222S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216188
AA Change: F222S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216907
AA Change: F222S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,654,505 T587I probably benign Het
Abl1 T A 2: 31,801,655 M1062K probably benign Het
Agbl4 G A 4: 111,547,272 D272N probably damaging Het
Apob A T 12: 8,008,261 I2215F probably damaging Het
Atp10b A T 11: 43,218,957 Q821H probably damaging Het
Atp1a3 T C 7: 24,979,304 Y971C probably damaging Het
Atp6ap1l A T 13: 90,883,722 H280Q probably damaging Het
B4galt2 A T 4: 117,876,967 M291K probably damaging Het
Cachd1 G T 4: 100,952,118 V267F possibly damaging Het
Cadm2 G T 16: 66,784,828 L188M probably damaging Het
Ceacam19 T C 7: 19,882,592 N199S probably benign Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Cluap1 T A 16: 3,928,612 M279K probably benign Het
Cngb1 T A 8: 95,264,424 M717L probably benign Het
Cp T C 3: 19,982,022 V777A probably benign Het
Drosha A G 15: 12,861,706 D594G probably benign Het
Exo5 A G 4: 120,921,537 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gprc5b A G 7: 118,984,577 I23T possibly damaging Het
Ikbke T C 1: 131,259,218 Y579C probably damaging Het
Ikzf2 T C 1: 69,539,042 Y362C probably damaging Het
Itfg1 A G 8: 85,740,349 V365A probably benign Het
Josd2 T C 7: 44,471,154 I105T probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Mettl22 T A 16: 8,488,891 probably null Het
Mgat5 A G 1: 127,471,564 I619V probably benign Het
Nin T C 12: 70,054,534 I430V probably benign Het
Olfr1047 T A 2: 86,228,387 I195F possibly damaging Het
Olfr1052 T C 2: 86,298,646 F277L probably benign Het
Olfr153 C G 2: 87,532,741 A236G possibly damaging Het
Olfr668 C A 7: 104,925,645 A40S possibly damaging Het
Parvb T C 15: 84,303,872 L272P probably damaging Het
Pde2a A G 7: 101,500,442 K180E possibly damaging Het
Pik3c3 C T 18: 30,324,562 T736M probably damaging Het
Plcb4 C T 2: 135,973,071 R760* probably null Het
Pramel6 C T 2: 87,510,422 T366I probably benign Het
Prr29 C T 11: 106,375,236 R42W probably damaging Het
Prss12 A G 3: 123,447,399 I81V probably benign Het
Ptpn13 A G 5: 103,501,612 T294A probably benign Het
Ptprc A T 1: 138,113,562 probably null Het
Sin3b T A 8: 72,733,490 probably null Het
Slco5a1 T C 1: 12,989,927 Y190C probably damaging Het
Slco6c1 T G 1: 97,125,813 Y121S probably damaging Het
Srcap G T 7: 127,522,145 G217* probably null Het
Ss18 A T 18: 14,651,088 M181K probably damaging Het
Synm T C 7: 67,736,061 T176A probably benign Het
Taf3 T C 2: 9,951,160 E579G probably damaging Het
Taf7 A G 18: 37,643,106 I136T probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tyrp1 A G 4: 80,840,781 D297G probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Wisp3 C T 10: 39,154,987 G180D probably benign Het
Wwp1 G A 4: 19,650,299 S289L possibly damaging Het
Xbp1 T C 11: 5,521,005 V4A probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb2 T C 10: 4,369,711 Y105C probably damaging Het
Zeb2 T C 2: 45,110,496 probably benign Het
Zkscan8 A T 13: 21,525,227 I167N probably benign Het
Other mutations in Olfr221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02559:Olfr221 APN 14 52036007 missense probably damaging 1.00
G4846:Olfr221 UTSW 14 52035977 missense probably benign 0.00
R0077:Olfr221 UTSW 14 52035985 missense possibly damaging 0.94
R4762:Olfr221 UTSW 14 52035464 missense possibly damaging 0.85
R5209:Olfr221 UTSW 14 52035953 missense probably benign
R5257:Olfr221 UTSW 14 52035884 missense possibly damaging 0.93
R6225:Olfr221 UTSW 14 52035368 missense possibly damaging 0.55
R7412:Olfr221 UTSW 14 52035853 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCACCGCTGTGTAGATCAC -3'
(R):5'- ATGGAGCAGGGTTTCTCAATTC -3'

Sequencing Primer
(F):5'- GTGTAGATCACGGCAACTGTGC -3'
(R):5'- AAGCTGCATCTTCAGTCTGAAC -3'
Posted On2018-06-06