Incidental Mutation 'R6702:Ubap2'
ID528799
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6702 (G1)
Quality Score217.468
Status Validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) GCCCGCTTGCCCCGCT to GCCCGCTTGCCCCGCTTGCCCCGCT at 41227210 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068]
Predicted Effect probably benign
Transcript: ENSMUST00000030143
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108068
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132499
Predicted Effect probably benign
Transcript: ENSMUST00000134782
SMART Domains Protein: ENSMUSP00000121724
Gene: ENSMUSG00000028433

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
UBA 61 99 9.62e-8 SMART
low complexity region 123 135 N/A INTRINSIC
low complexity region 138 152 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 unclassified probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 unclassified probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGACAGGCAACCTTCAG -3'
(R):5'- AGCCTTTGGTCATGTGCTTC -3'

Sequencing Primer
(F):5'- GGCAACCTTCAGCACCAAAAATAAC -3'
(R):5'- GACAGGTGCTCCCTCAATATGTAG -3'
Posted On2018-07-24