Incidental Mutation 'R6721:Olfr18'
ID529593
Institutional Source Beutler Lab
Gene Symbol Olfr18
Ensembl Gene ENSMUSG00000066896
Gene Nameolfactory receptor 18
SynonymsGA_x6K02T2PVTD-14054886-14053957, MOR145-1, MTPCR34
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6721 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20312152-20336094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20314280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 213 (D213E)
Ref Sequence ENSEMBL: ENSMUSP00000083664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086473] [ENSMUST00000212943]
Predicted Effect probably benign
Transcript: ENSMUST00000086473
AA Change: D213E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083664
Gene: ENSMUSG00000066896
AA Change: D213E

DomainStartEndE-ValueType
Pfam:7tm_4 53 330 1.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 57 234 3.2e-9 PFAM
Pfam:7tm_1 63 312 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211895
Predicted Effect probably benign
Transcript: ENSMUST00000212943
AA Change: D205E

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220241
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,874,744 N44D probably benign Het
2610507B11Rik T C 11: 78,279,799 Y1615H probably damaging Het
Adgrv1 A G 13: 81,481,515 L3588S probably benign Het
Ankrd27 T C 7: 35,612,551 F402S probably damaging Het
Aplp1 T C 7: 30,440,295 Q359R probably null Het
Arhgef10l T C 4: 140,570,344 Y546C probably damaging Het
Cd46 T C 1: 195,083,631 Y142C probably damaging Het
Chd3 T C 11: 69,369,219 probably benign Het
Cmtm2b A G 8: 104,322,445 S31G possibly damaging Het
CN725425 A G 15: 91,231,618 K21R possibly damaging Het
Cngb1 T C 8: 95,270,888 T560A probably benign Het
Creb3l3 T C 10: 81,091,143 D151G probably damaging Het
Cts7 A T 13: 61,356,294 V124E probably damaging Het
Ctsd G A 7: 142,376,853 P349S possibly damaging Het
Ern1 A G 11: 106,411,652 W459R probably damaging Het
Faxc A T 4: 21,982,672 probably null Het
Gabbr1 T C 17: 37,054,192 I239T probably damaging Het
Galnt12 T A 4: 47,122,529 C269* probably null Het
Gmpr2 A T 14: 55,672,734 D7V probably damaging Het
Hivep3 T A 4: 120,095,099 I204N possibly damaging Het
Il16 A T 7: 83,663,062 probably null Het
Jag1 T C 2: 137,094,474 T367A probably benign Het
Lefty2 T C 1: 180,894,601 V168A probably damaging Het
Mecom T C 3: 29,979,874 E227G probably damaging Het
Muc5ac T A 7: 141,798,992 C739S possibly damaging Het
Npy1r T A 8: 66,704,289 C120* probably null Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Ogfr T A 2: 180,595,428 L602Q possibly damaging Het
Olfr1564 C T 17: 33,215,534 G270E probably benign Het
Olfr978 C T 9: 39,994,307 P166S possibly damaging Het
Perm1 G T 4: 156,218,319 R440L probably benign Het
Plcb4 T C 2: 135,910,237 V121A probably benign Het
Plxna4 C T 6: 32,200,859 V1036M probably benign Het
Ppl A T 16: 5,107,469 M102K probably damaging Het
Prop1 T C 11: 50,953,386 S7G probably benign Het
Rabggta A G 14: 55,717,203 L507P probably damaging Het
Sfmbt2 A G 2: 10,543,025 T473A probably damaging Het
Spc25 A C 2: 69,197,173 M125R possibly damaging Het
Taok3 T C 5: 117,255,863 M567T probably benign Het
Tlr3 A G 8: 45,398,880 Y327H probably benign Het
Tmem209 A G 6: 30,497,175 F339L probably benign Het
U2surp T C 9: 95,491,104 N279S probably damaging Het
Ythdf3 G A 3: 16,203,861 M61I possibly damaging Het
Zfp647 T C 15: 76,911,876 I195V probably benign Het
Other mutations in Olfr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Olfr18 APN 9 20314719 missense probably damaging 1.00
IGL02412:Olfr18 APN 9 20314639 missense probably benign
IGL03288:Olfr18 APN 9 20335911 critical splice donor site probably null
IGL03395:Olfr18 APN 9 20314551 missense probably damaging 1.00
R0332:Olfr18 UTSW 9 20314056 missense probably benign 0.00
R0346:Olfr18 UTSW 9 20314411 missense probably benign 0.20
R0569:Olfr18 UTSW 9 20314579 missense probably damaging 1.00
R0798:Olfr18 UTSW 9 20314199 nonsense probably null
R0865:Olfr18 UTSW 9 20314749 missense probably damaging 1.00
R1082:Olfr18 UTSW 9 20314469 missense possibly damaging 0.52
R1905:Olfr18 UTSW 9 20314846 missense probably benign
R4245:Olfr18 UTSW 9 20314333 missense possibly damaging 0.87
R5566:Olfr18 UTSW 9 20313969 missense probably benign
R6306:Olfr18 UTSW 9 20314446 missense probably benign 0.25
R6787:Olfr18 UTSW 9 20335925 missense probably benign
R6930:Olfr18 UTSW 9 20314099 missense probably damaging 1.00
R7196:Olfr18 UTSW 9 20314198 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTCCTGGGAGACAAGGACACAG -3'
(R):5'- TGAACCCTCGTCTTTGTGGC -3'

Sequencing Primer
(F):5'- GCTGAACTGAGGTATACCCC -3'
(R):5'- CCCTCGTCTTTGTGGCTTGTTG -3'
Posted On2018-08-01