Incidental Mutation 'R6738:Col11a1'
ID530298
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Namecollagen, type XI, alpha 1
SynonymsC530001D20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location114030540-114220718 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 114112467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000123619]
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: H612R
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: H612R

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123619
SMART Domains Protein: ENSMUSP00000121027
Gene: ENSMUSG00000027966

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 259 296 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Pfam:Collagen 446 503 6.9e-10 PFAM
low complexity region 521 538 N/A INTRINSIC
low complexity region 545 566 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 114066533 missense unknown
IGL00578:Col11a1 APN 3 114194106 missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 114124315 missense unknown
IGL01014:Col11a1 APN 3 114123809 splice site probably benign
IGL01099:Col11a1 APN 3 114112041 nonsense probably null
IGL01129:Col11a1 APN 3 114185873 splice site probably benign
IGL01474:Col11a1 APN 3 114217134 utr 3 prime probably benign
IGL01884:Col11a1 APN 3 114066542 missense unknown
IGL02104:Col11a1 APN 3 114181397 critical splice donor site probably null
IGL02715:Col11a1 APN 3 114129409 missense probably benign 0.06
IGL02978:Col11a1 APN 3 114061562 missense unknown
IGL03203:Col11a1 APN 3 114212084 missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114217210 splice site probably null
IGL03357:Col11a1 APN 3 114194091 missense probably damaging 1.00
IGL03390:Col11a1 APN 3 114090253 missense unknown
gluon UTSW 3 114217170 utr 3 prime probably benign
uncovered UTSW 3 114112467 unclassified probably benign
R0110:Col11a1 UTSW 3 114105456 splice site probably benign
R0144:Col11a1 UTSW 3 114113594 missense unknown
R0432:Col11a1 UTSW 3 114205901 splice site probably benign
R0468:Col11a1 UTSW 3 114217058 utr 3 prime probably benign
R0510:Col11a1 UTSW 3 114105456 splice site probably benign
R0535:Col11a1 UTSW 3 114061535 missense unknown
R0608:Col11a1 UTSW 3 114218715 utr 3 prime probably benign
R0826:Col11a1 UTSW 3 114138765 missense unknown
R0827:Col11a1 UTSW 3 114138765 missense unknown
R0862:Col11a1 UTSW 3 114138765 missense unknown
R0863:Col11a1 UTSW 3 114138765 missense unknown
R0926:Col11a1 UTSW 3 114090180 missense unknown
R0980:Col11a1 UTSW 3 114138765 missense unknown
R0981:Col11a1 UTSW 3 114138765 missense unknown
R1004:Col11a1 UTSW 3 114095022 splice site probably benign
R1037:Col11a1 UTSW 3 114194152 missense probably damaging 1.00
R1171:Col11a1 UTSW 3 114066564 missense unknown
R1316:Col11a1 UTSW 3 114138970 splice site probably null
R1324:Col11a1 UTSW 3 114030916 missense unknown
R1338:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1513:Col11a1 UTSW 3 114097154 missense unknown
R1528:Col11a1 UTSW 3 114216995 utr 3 prime probably benign
R1567:Col11a1 UTSW 3 114138612 missense unknown
R1596:Col11a1 UTSW 3 114152613 utr 3 prime probably benign
R1605:Col11a1 UTSW 3 114131641 missense probably damaging 1.00
R1624:Col11a1 UTSW 3 114158155 missense probably damaging 0.97
R1626:Col11a1 UTSW 3 114131569 missense probably damaging 1.00
R1666:Col11a1 UTSW 3 114061535 missense unknown
R1806:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2001:Col11a1 UTSW 3 114165293 splice site probably null
R2084:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R2085:Col11a1 UTSW 3 114158142 missense probably damaging 1.00
R3926:Col11a1 UTSW 3 114090124 splice site probably benign
R3950:Col11a1 UTSW 3 114121445 critical splice donor site probably null
R3970:Col11a1 UTSW 3 114097189 missense unknown
R4171:Col11a1 UTSW 3 114208214 missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114208223 missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 114108316 missense unknown
R4540:Col11a1 UTSW 3 114097166 missense unknown
R5210:Col11a1 UTSW 3 114153157 missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114217170 utr 3 prime probably benign
R5335:Col11a1 UTSW 3 114095240 missense unknown
R5344:Col11a1 UTSW 3 114208362 critical splice donor site probably null
R5394:Col11a1 UTSW 3 114194184 splice site probably null
R5687:Col11a1 UTSW 3 114217103 utr 3 prime probably benign
R5708:Col11a1 UTSW 3 114097094 missense unknown
R5763:Col11a1 UTSW 3 114094596 intron probably benign
R5792:Col11a1 UTSW 3 114131593 missense probably damaging 1.00
R6259:Col11a1 UTSW 3 114138447 missense probably benign
R6679:Col11a1 UTSW 3 114152719 splice site probably null
R6747:Col11a1 UTSW 3 114212450 nonsense probably null
R6808:Col11a1 UTSW 3 114094944 missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 114167492 missense probably damaging 1.00
R7201:Col11a1 UTSW 3 114090157 missense unknown
R7264:Col11a1 UTSW 3 114185599 missense unknown
R7393:Col11a1 UTSW 3 114097106 missense unknown
R7445:Col11a1 UTSW 3 114193929 missense unknown
R7479:Col11a1 UTSW 3 114102569 missense unknown
R7548:Col11a1 UTSW 3 114123760 missense unknown
X0018:Col11a1 UTSW 3 114112233 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTAAGGTCAGGACTTGATAAC -3'
(R):5'- GGCACTGTGTATAATCTGCATC -3'

Sequencing Primer
(F):5'- GCAGATAATGTTTGGCACTTTATCC -3'
(R):5'- CACTGTGTATAATCTGCATCTACATG -3'
Posted On2018-08-01