Incidental Mutation 'R6764:Smco2'
ID531817
Institutional Source Beutler Lab
Gene Symbol Smco2
Ensembl Gene ENSMUSG00000030292
Gene Namesingle-pass membrane protein with coiled-coil domains 2
Synonyms1700023A16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6764 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146850104-146871406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146871329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 343 (D343G)
Ref Sequence ENSEMBL: ENSMUSP00000032433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032433]
Predicted Effect probably damaging
Transcript: ENSMUST00000032433
AA Change: D343G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032433
Gene: ENSMUSG00000030292
AA Change: D343G

DomainStartEndE-ValueType
Pfam:TMCO5 1 121 3.6e-14 PFAM
Pfam:TMCO5 142 346 2.5e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A G 19: 5,502,872 S294P probably damaging Het
Aff4 G T 11: 53,399,830 R539L probably damaging Het
Aox2 T A 1: 58,350,282 Y1147N probably damaging Het
Arhgef25 A G 10: 127,184,101 F423L probably damaging Het
Atp1a2 A T 1: 172,284,614 D571E probably benign Het
Bank1 A G 3: 136,242,940 S159P probably damaging Het
Bcan C A 3: 87,988,378 R817L probably damaging Het
Cacna1g A G 11: 94,413,188 S1990P possibly damaging Het
Ccna1 G A 3: 55,046,078 T368M probably damaging Het
Chia1 T C 3: 106,130,740 probably null Het
Ctbp1 T C 5: 33,259,245 H136R possibly damaging Het
Dner T G 1: 84,494,781 D366A probably damaging Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Evpl A G 11: 116,222,944 S1307P probably damaging Het
Fgd5 T A 6: 91,989,421 N720K probably damaging Het
Fmn1 A G 2: 113,525,215 E667G unknown Het
Gm4846 A G 1: 166,491,552 C206R probably benign Het
Grpel1 G A 5: 36,465,225 R11H probably benign Het
Gsn A G 2: 35,284,044 Y55C probably damaging Het
Hephl1 G A 9: 15,088,921 T345I possibly damaging Het
Ints2 T A 11: 86,212,779 K1150N probably benign Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Musk T C 4: 58,354,027 V360A probably damaging Het
Naalad2 A T 9: 18,402,889 probably benign Het
Ninj2 G T 6: 120,198,050 A51S probably benign Het
Pcdhac1 T C 18: 37,090,679 Y182H probably damaging Het
Pitpnm3 A G 11: 72,051,233 F916S probably damaging Het
Sfrp5 T A 19: 42,199,799 M194L probably benign Het
Sigirr C T 7: 141,093,242 V99I probably benign Het
Snap91 A G 9: 86,792,181 I584T probably benign Het
Syne1 G A 10: 5,229,011 Q4488* probably null Het
Tbc1d24 A C 17: 24,185,780 F130C possibly damaging Het
Trpm7 A G 2: 126,844,420 V296A possibly damaging Het
Ttll11 T C 2: 35,890,448 probably null Het
Vmn2r115 A G 17: 23,346,072 D311G probably damaging Het
Vmn2r63 A G 7: 42,903,271 S854P probably damaging Het
Zfp330 C T 8: 82,767,305 C109Y probably damaging Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp62 A G 11: 49,215,169 D29G probably damaging Het
Other mutations in Smco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Smco2 APN 6 146861710 missense probably benign 0.38
IGL03082:Smco2 APN 6 146860044 missense possibly damaging 0.52
R0256:Smco2 UTSW 6 146861746 missense probably damaging 1.00
R0402:Smco2 UTSW 6 146871135 critical splice acceptor site probably benign
R1144:Smco2 UTSW 6 146871140 critical splice acceptor site probably benign
R1335:Smco2 UTSW 6 146862087 intron probably benign
R2508:Smco2 UTSW 6 146859967 missense probably damaging 1.00
R4560:Smco2 UTSW 6 146871176 missense possibly damaging 0.94
R4701:Smco2 UTSW 6 146861942 intron probably benign
R4987:Smco2 UTSW 6 146856092 missense possibly damaging 0.59
R5322:Smco2 UTSW 6 146871287 missense probably damaging 1.00
R7023:Smco2 UTSW 6 146858856 nonsense probably null
R7090:Smco2 UTSW 6 146871213 missense probably damaging 0.97
R7220:Smco2 UTSW 6 146858865 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGTTCGTCATAGTCTACG -3'
(R):5'- TTGTAAGAGCTCAGCCTCCC -3'

Sequencing Primer
(F):5'- TACGTGGTCACCATCACTGGAC -3'
(R):5'- GCATTATGAATTCGGGACTAGCCTC -3'
Posted On2018-08-29