Incidental Mutation 'R6764:Ints2'
ID531829
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6764 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86212779 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1150 (K1150N)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: K1150N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: K1150N

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: K1150N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: K1150N

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A G 19: 5,502,872 S294P probably damaging Het
Aff4 G T 11: 53,399,830 R539L probably damaging Het
Aox2 T A 1: 58,350,282 Y1147N probably damaging Het
Arhgef25 A G 10: 127,184,101 F423L probably damaging Het
Atp1a2 A T 1: 172,284,614 D571E probably benign Het
Bank1 A G 3: 136,242,940 S159P probably damaging Het
Bcan C A 3: 87,988,378 R817L probably damaging Het
Cacna1g A G 11: 94,413,188 S1990P possibly damaging Het
Ccna1 G A 3: 55,046,078 T368M probably damaging Het
Chia1 T C 3: 106,130,740 probably null Het
Ctbp1 T C 5: 33,259,245 H136R possibly damaging Het
Dner T G 1: 84,494,781 D366A probably damaging Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Evpl A G 11: 116,222,944 S1307P probably damaging Het
Fgd5 T A 6: 91,989,421 N720K probably damaging Het
Fmn1 A G 2: 113,525,215 E667G unknown Het
Gm4846 A G 1: 166,491,552 C206R probably benign Het
Grpel1 G A 5: 36,465,225 R11H probably benign Het
Gsn A G 2: 35,284,044 Y55C probably damaging Het
Hephl1 G A 9: 15,088,921 T345I possibly damaging Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Musk T C 4: 58,354,027 V360A probably damaging Het
Naalad2 A T 9: 18,402,889 probably benign Het
Ninj2 G T 6: 120,198,050 A51S probably benign Het
Pcdhac1 T C 18: 37,090,679 Y182H probably damaging Het
Pitpnm3 A G 11: 72,051,233 F916S probably damaging Het
Sfrp5 T A 19: 42,199,799 M194L probably benign Het
Sigirr C T 7: 141,093,242 V99I probably benign Het
Smco2 A G 6: 146,871,329 D343G probably damaging Het
Snap91 A G 9: 86,792,181 I584T probably benign Het
Syne1 G A 10: 5,229,011 Q4488* probably null Het
Tbc1d24 A C 17: 24,185,780 F130C possibly damaging Het
Trpm7 A G 2: 126,844,420 V296A possibly damaging Het
Ttll11 T C 2: 35,890,448 probably null Het
Vmn2r115 A G 17: 23,346,072 D311G probably damaging Het
Vmn2r63 A G 7: 42,903,271 S854P probably damaging Het
Zfp330 C T 8: 82,767,305 C109Y probably damaging Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp62 A G 11: 49,215,169 D29G probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCAGATTCAGTATAGCAAGTGG -3'
(R):5'- GTCGAGCATTTCCTCCACTG -3'

Sequencing Primer
(F):5'- GCAAGTGGCTGCACTTAAAAC -3'
(R):5'- GAGCATTTCCTCCACTGTATGAGG -3'
Posted On2018-08-29