Incidental Mutation 'R6829:1700011H14Rik'
List |< first << previous [record 3 of 958] next >> last >|
ID534312
Institutional Source Beutler Lab
Gene Symbol 1700011H14Rik
Ensembl Gene ENSMUSG00000021850
Gene NameRIKEN cDNA 1700011H14 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6829 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location49219588-49245474 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 49226568 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 295 (*295Q)
Ref Sequence ENSEMBL: ENSMUSP00000154726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022398] [ENSMUST00000148109] [ENSMUST00000228936]
Predicted Effect probably null
Transcript: ENSMUST00000022398
AA Change: *304Q
SMART Domains Protein: ENSMUSP00000022398
Gene: ENSMUSG00000021850
AA Change: *304Q

DomainStartEndE-ValueType
Pfam:DUF4619 1 294 1e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148109
SMART Domains Protein: ENSMUSP00000114834
Gene: ENSMUSG00000021850

DomainStartEndE-ValueType
Pfam:DUF4619 1 65 3.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228936
AA Change: *295Q
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 A T 14: 66,027,997 probably null Het
Adamts5 A T 16: 85,870,071 M511K possibly damaging Het
Adcy9 A G 16: 4,307,154 probably null Het
Cast T C 13: 74,728,344 E113G possibly damaging Het
Dcaf1 T A 9: 106,838,604 S307T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Elac2 A G 11: 64,989,364 E111G probably benign Het
Fam208a A G 14: 27,442,481 D248G possibly damaging Het
Fbxw4 A G 19: 45,636,374 F57S possibly damaging Het
Gm17655 T G 5: 110,046,926 H330P probably damaging Het
Gm2a T C 11: 55,103,750 probably null Het
Gon4l T A 3: 88,880,106 D600E possibly damaging Het
Gsg1l2 T C 11: 67,774,858 I84T possibly damaging Het
Igsf9 A G 1: 172,495,674 R652G probably benign Het
Il17rd C T 14: 27,087,422 R112* probably null Het
Jph1 C A 1: 17,004,423 R457L probably damaging Het
Khdrbs3 T C 15: 69,092,961 V249A possibly damaging Het
Mocs2 A G 13: 114,819,444 S43G probably benign Het
Myom2 T A 8: 15,122,643 L1190* probably null Het
Olfr1080 A T 2: 86,553,269 L285* probably null Het
Olfr1318 G C 2: 112,155,794 probably benign Het
Olfr198 A G 16: 59,201,535 V297A probably damaging Het
Olfr263 T A 13: 21,132,853 I26N possibly damaging Het
Plch1 T G 3: 63,697,518 D1655A probably damaging Het
Pnliprp2 G A 19: 58,759,873 G29R probably benign Het
Polg A G 7: 79,460,109 V382A probably benign Het
Rb1cc1 T C 1: 6,249,264 I969T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sema7a A G 9: 57,960,898 E538G probably benign Het
Slc2a2 C T 3: 28,727,441 Q513* probably null Het
Slc4a8 A G 15: 100,800,538 Y636C probably damaging Het
Trpm5 A G 7: 143,069,429 probably benign Het
Vmn1r14 T C 6: 57,233,551 L38P probably benign Het
Washc4 T C 10: 83,560,516 S397P probably damaging Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zan A G 5: 137,416,278 probably benign Het
Zfhx3 C T 8: 108,950,283 T2655M probably damaging Het
Other mutations in 1700011H14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:1700011H14Rik APN 14 49235884 missense probably benign 0.02
IGL02133:1700011H14Rik APN 14 49232967 missense probably benign 0.05
IGL03325:1700011H14Rik APN 14 49243820 splice site probably benign
R1751:1700011H14Rik UTSW 14 49235884 missense probably benign 0.09
R1767:1700011H14Rik UTSW 14 49235884 missense probably benign 0.09
R1846:1700011H14Rik UTSW 14 49235963 missense probably damaging 1.00
R1908:1700011H14Rik UTSW 14 49226575 missense probably damaging 1.00
R4563:1700011H14Rik UTSW 14 49234498 missense probably benign 0.27
R4883:1700011H14Rik UTSW 14 49245103 missense probably damaging 1.00
R4915:1700011H14Rik UTSW 14 49232894 missense probably benign 0.01
R5381:1700011H14Rik UTSW 14 49232907 missense probably damaging 1.00
R5986:1700011H14Rik UTSW 14 49232946 missense probably damaging 1.00
R6379:1700011H14Rik UTSW 14 49243734 missense probably benign 0.02
R6841:1700011H14Rik UTSW 14 49243813 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCATACATGACAAGGCTATTCATCAC -3'
(R):5'- CCCCAAGATGAAGAATTCTTGGAC -3'

Sequencing Primer
(F):5'- GGCTATTCATCACAAGATTCCAG -3'
(R):5'- GAAGAATTCTTGGACTGTCACACAG -3'
Posted On2018-09-12