Incidental Mutation 'R6872:Abcg3'
ID536199
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene NameATP binding cassette subfamily G member 3
SynonymsMxr2, Abcp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6872 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104935057-104982718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104935994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 637 (T637A)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: T637A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: T637A

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Ap3d1 G A 10: 80,714,322 R692* probably null Het
Aqp2 C T 15: 99,584,004 H260Y probably benign Het
Btbd2 C A 10: 80,644,332 R383L probably damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Col12a1 A T 9: 79,677,234 N1357K probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Ddo A C 10: 40,637,418 M119L possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Eng T A 2: 32,673,275 I281N probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Gsdmc T C 15: 63,778,707 D275G possibly damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Lmod1 G T 1: 135,365,141 R578L probably damaging Het
Mindy2 A G 9: 70,616,762 probably null Het
Neb G T 2: 52,293,645 Q1004K probably damaging Het
Nkx2-9 T G 12: 56,611,889 N180T probably benign Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nol4l T C 2: 153,483,817 E116G probably damaging Het
Olfr201 A G 16: 59,269,598 L23P probably benign Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Ramp3 T C 11: 6,674,768 C21R possibly damaging Het
Rpap1 A C 2: 119,775,369 M345R probably damaging Het
Serpina3k A C 12: 104,344,260 K350Q probably benign Het
St13 C T 15: 81,366,346 probably null Het
Stard9 A T 2: 120,714,068 K4497* probably null Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Trim69 A G 2: 122,167,910 E121G probably damaging Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zbtb7a A G 10: 81,148,071 N449S possibly damaging Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp462 G A 4: 55,012,326 A1431T probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Zfp706 T C 15: 37,001,946 T46A possibly damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 104936012 missense probably benign 0.02
IGL01363:Abcg3 APN 5 104948362 missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 104961186 missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 104969452 missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 104977670 missense probably benign 0.18
IGL02974:Abcg3 APN 5 104968263 missense probably damaging 1.00
IGL03058:Abcg3 APN 5 104961246 missense probably benign 0.00
IGL03153:Abcg3 APN 5 104974765 splice site probably benign
IGL03377:Abcg3 APN 5 104948390 missense probably benign 0.01
R0110:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0469:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0510:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0530:Abcg3 UTSW 5 104936054 missense probably damaging 1.00
R0579:Abcg3 UTSW 5 104974103 missense probably damaging 1.00
R1237:Abcg3 UTSW 5 104948357 missense probably damaging 0.96
R1505:Abcg3 UTSW 5 104951565 missense probably damaging 1.00
R1627:Abcg3 UTSW 5 104936014 missense probably benign 0.00
R1717:Abcg3 UTSW 5 104963555 nonsense probably null
R1797:Abcg3 UTSW 5 104939164 missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 104938199 missense probably damaging 0.99
R1974:Abcg3 UTSW 5 104963638 missense probably benign 0.01
R2136:Abcg3 UTSW 5 104966814 missense probably benign 0.04
R2285:Abcg3 UTSW 5 104939171 missense probably damaging 1.00
R3880:Abcg3 UTSW 5 104938180 splice site probably benign
R4242:Abcg3 UTSW 5 104961213 missense probably benign
R4738:Abcg3 UTSW 5 104973983 missense probably benign
R5225:Abcg3 UTSW 5 104966783 missense probably damaging 1.00
R5309:Abcg3 UTSW 5 104936599 missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5705:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5785:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R6155:Abcg3 UTSW 5 104963644 missense probably benign 0.00
R6309:Abcg3 UTSW 5 104969393 critical splice donor site probably null
R6814:Abcg3 UTSW 5 104935994 missense probably benign
R6916:Abcg3 UTSW 5 104974735 missense probably benign 0.16
R7217:Abcg3 UTSW 5 104939228 missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 104966766 missense probably benign 0.01
R7343:Abcg3 UTSW 5 104968234 missense probably benign 0.00
R7401:Abcg3 UTSW 5 104966774 missense probably damaging 0.99
X0022:Abcg3 UTSW 5 104948416 missense probably benign 0.02
X0026:Abcg3 UTSW 5 104938189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGATCCAGTCTTATGCAG -3'
(R):5'- TTAAGGGAAGCAACAGTGAATCTAC -3'

Sequencing Primer
(F):5'- TGTGAGCAGCCATAAGTCTC -3'
(R):5'- TTGATCTCTCATCGTGGG -3'
Posted On2018-10-18