Incidental Mutation 'R5309:Abcg3'
ID404711
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene NameATP binding cassette subfamily G member 3
SynonymsMxr2, Abcp2
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104935057-104982718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104936599 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 577 (C577G)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
Predicted Effect probably benign
Transcript: ENSMUST00000031239
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130644
AA Change: C577G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: C577G

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178720
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 104936012 missense probably benign 0.02
IGL01363:Abcg3 APN 5 104948362 missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 104961186 missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 104969452 missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 104977670 missense probably benign 0.18
IGL02974:Abcg3 APN 5 104968263 missense probably damaging 1.00
IGL03058:Abcg3 APN 5 104961246 missense probably benign 0.00
IGL03153:Abcg3 APN 5 104974765 splice site probably benign
IGL03377:Abcg3 APN 5 104948390 missense probably benign 0.01
R0110:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0469:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0510:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0530:Abcg3 UTSW 5 104936054 missense probably damaging 1.00
R0579:Abcg3 UTSW 5 104974103 missense probably damaging 1.00
R1237:Abcg3 UTSW 5 104948357 missense probably damaging 0.96
R1505:Abcg3 UTSW 5 104951565 missense probably damaging 1.00
R1627:Abcg3 UTSW 5 104936014 missense probably benign 0.00
R1717:Abcg3 UTSW 5 104963555 nonsense probably null
R1797:Abcg3 UTSW 5 104939164 missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 104938199 missense probably damaging 0.99
R1974:Abcg3 UTSW 5 104963638 missense probably benign 0.01
R2136:Abcg3 UTSW 5 104966814 missense probably benign 0.04
R2285:Abcg3 UTSW 5 104939171 missense probably damaging 1.00
R3880:Abcg3 UTSW 5 104938180 splice site probably benign
R4242:Abcg3 UTSW 5 104961213 missense probably benign
R4738:Abcg3 UTSW 5 104973983 missense probably benign
R5225:Abcg3 UTSW 5 104966783 missense probably damaging 1.00
R5704:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5705:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5785:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R6155:Abcg3 UTSW 5 104963644 missense probably benign 0.00
R6309:Abcg3 UTSW 5 104969393 critical splice donor site probably null
R6814:Abcg3 UTSW 5 104935994 missense probably benign
R6872:Abcg3 UTSW 5 104935994 missense probably benign
R6916:Abcg3 UTSW 5 104974735 missense probably benign 0.16
R7217:Abcg3 UTSW 5 104939228 missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 104966766 missense probably benign 0.01
R7343:Abcg3 UTSW 5 104968234 missense probably benign 0.00
R7401:Abcg3 UTSW 5 104966774 missense probably damaging 0.99
X0022:Abcg3 UTSW 5 104948416 missense probably benign 0.02
X0026:Abcg3 UTSW 5 104938189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACTTCACGGTGTCATTCC -3'
(R):5'- GGAATAGACTCCCAGCTGAAAC -3'

Sequencing Primer
(F):5'- ACGGTGTCATTCCTTTCTGAATC -3'
(R):5'- AGGACCAAGGGCCTCTCTTC -3'
Posted On2016-07-22