Incidental Mutation 'R6872:Ap3d1'
ID 536219
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Name adaptor-related protein complex 3, delta 1 subunit
Synonyms mBLVR1, Bolvr
MMRRC Submission 044969-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R6872 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80542790-80578098 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 80550156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 692 (R692*)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]
AlphaFold O54774
Predicted Effect probably null
Transcript: ENSMUST00000020420
AA Change: R692*
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: R692*

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,349,750 (GRCm39) V336I probably benign Het
Aadacl4fm4 A T 4: 144,397,216 (GRCm39) L172* probably null Het
Abcg3 T C 5: 105,083,860 (GRCm39) T637A probably benign Het
Aqp2 C T 15: 99,481,885 (GRCm39) H260Y probably benign Het
Btbd2 C A 10: 80,480,166 (GRCm39) R383L probably damaging Het
Ccdc196 T A 12: 78,244,141 (GRCm39) D31E probably damaging Het
Ccdc24 T C 4: 117,727,123 (GRCm39) T196A probably benign Het
Cdc20b G A 13: 113,220,509 (GRCm39) G463S probably damaging Het
Ceacam5 A T 7: 17,486,212 (GRCm39) R570* probably null Het
Col12a1 A T 9: 79,584,516 (GRCm39) N1357K probably damaging Het
Cpa5 A T 6: 30,614,053 (GRCm39) Q65L probably benign Het
Ddo A C 10: 40,513,414 (GRCm39) M119L possibly damaging Het
Dnah8 G T 17: 30,981,653 (GRCm39) L3058F probably damaging Het
Dnajb8 A G 6: 88,200,022 (GRCm39) N186S probably damaging Het
Dock4 T C 12: 40,862,325 (GRCm39) probably null Het
Ear6 A G 14: 52,091,885 (GRCm39) Y144C probably damaging Het
Eng T A 2: 32,563,287 (GRCm39) I281N probably damaging Het
Fgf2 A G 3: 37,458,860 (GRCm39) K85E probably damaging Het
Fubp1 A T 3: 151,931,783 (GRCm39) Q37L probably benign Het
Gabra2 G T 5: 71,251,882 (GRCm39) P22T probably damaging Het
Gm10401 T C 5: 115,236,245 (GRCm39) probably benign Het
Gsdmc T C 15: 63,650,556 (GRCm39) D275G possibly damaging Het
Iglv3 A G 16: 19,060,034 (GRCm39) I98T probably damaging Het
Lmod1 G T 1: 135,292,879 (GRCm39) R578L probably damaging Het
Mindy2 A G 9: 70,524,044 (GRCm39) probably null Het
Neb G T 2: 52,183,657 (GRCm39) Q1004K probably damaging Het
Nkx2-9 T G 12: 56,658,674 (GRCm39) N180T probably benign Het
Nlrp2 C T 7: 5,311,709 (GRCm39) R922H probably benign Het
Nol4l T C 2: 153,325,737 (GRCm39) E116G probably damaging Het
Or1af1 A T 2: 37,109,989 (GRCm39) M163L possibly damaging Het
Or5ac19 A G 16: 59,089,961 (GRCm39) L23P probably benign Het
Pcdhb20 A C 18: 37,639,218 (GRCm39) E581D probably benign Het
Pidd1 G T 7: 141,019,331 (GRCm39) T750K probably benign Het
Rab44 A G 17: 29,358,784 (GRCm39) E324G probably benign Het
Ramp3 T C 11: 6,624,768 (GRCm39) C21R possibly damaging Het
Rpap1 A C 2: 119,605,850 (GRCm39) M345R probably damaging Het
Serpina3k A C 12: 104,310,519 (GRCm39) K350Q probably benign Het
St13 C T 15: 81,250,547 (GRCm39) probably null Het
Stard9 A T 2: 120,544,549 (GRCm39) K4497* probably null Het
Tbx19 A T 1: 164,975,202 (GRCm39) probably null Het
Tgoln1 A G 6: 72,592,538 (GRCm39) V314A possibly damaging Het
Them4 A T 3: 94,231,678 (GRCm39) I172F probably damaging Het
Tmc7 T A 7: 118,146,846 (GRCm39) Y477F probably benign Het
Tmem132a A G 19: 10,840,669 (GRCm39) L421P probably damaging Het
Trim69 A G 2: 121,998,391 (GRCm39) E121G probably damaging Het
Vmn2r11 T G 5: 109,194,976 (GRCm39) R783S possibly damaging Het
Vmn2r62 T A 7: 42,438,412 (GRCm39) L141F probably benign Het
Zbtb7a A G 10: 80,983,905 (GRCm39) N449S possibly damaging Het
Zfhx3 C T 8: 109,527,273 (GRCm39) R1057W probably damaging Het
Zfp180 G T 7: 23,805,306 (GRCm39) C575F probably damaging Het
Zfp462 G A 4: 55,012,326 (GRCm39) A1431T probably benign Het
Zfp592 T C 7: 80,673,576 (GRCm39) V180A probably benign Het
Zfp605 C T 5: 110,275,311 (GRCm39) P143L probably benign Het
Zfp646 T C 7: 127,482,505 (GRCm39) S1561P probably benign Het
Zfp706 T C 15: 37,002,190 (GRCm39) T46A possibly damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80,577,813 (GRCm39) missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80,549,393 (GRCm39) missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80,554,993 (GRCm39) missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80,545,092 (GRCm39) nonsense probably null
IGL03404:Ap3d1 APN 10 80,565,871 (GRCm39) missense probably damaging 1.00
christian UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
Particle UTSW 10 80,546,328 (GRCm39) splice site probably null
vesicle UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80,559,449 (GRCm39) splice site probably benign
R0197:Ap3d1 UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80,563,812 (GRCm39) missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80,559,401 (GRCm39) missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80,555,075 (GRCm39) missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80,555,216 (GRCm39) nonsense probably null
R0792:Ap3d1 UTSW 10 80,544,313 (GRCm39) missense probably benign
R0942:Ap3d1 UTSW 10 80,568,789 (GRCm39) splice site probably benign
R1015:Ap3d1 UTSW 10 80,552,323 (GRCm39) missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80,550,092 (GRCm39) missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80,568,674 (GRCm39) splice site probably benign
R1540:Ap3d1 UTSW 10 80,551,775 (GRCm39) missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80,565,844 (GRCm39) missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80,553,571 (GRCm39) nonsense probably null
R1669:Ap3d1 UTSW 10 80,546,670 (GRCm39) unclassified probably benign
R1839:Ap3d1 UTSW 10 80,562,942 (GRCm39) missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80,545,607 (GRCm39) missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80,568,770 (GRCm39) missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80,556,966 (GRCm39) missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80,549,832 (GRCm39) missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80,555,006 (GRCm39) nonsense probably null
R2849:Ap3d1 UTSW 10 80,577,742 (GRCm39) missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80,548,019 (GRCm39) missense probably benign
R4350:Ap3d1 UTSW 10 80,555,119 (GRCm39) missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80,555,646 (GRCm39) nonsense probably null
R4782:Ap3d1 UTSW 10 80,557,420 (GRCm39) splice site probably null
R4785:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R4834:Ap3d1 UTSW 10 80,555,560 (GRCm39) missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R5051:Ap3d1 UTSW 10 80,555,033 (GRCm39) missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80,545,284 (GRCm39) missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80,545,651 (GRCm39) missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80,563,001 (GRCm39) missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80,559,383 (GRCm39) missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80,554,964 (GRCm39) missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80,549,871 (GRCm39) missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80,546,298 (GRCm39) missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80,546,328 (GRCm39) splice site probably null
R6469:Ap3d1 UTSW 10 80,547,992 (GRCm39) missense probably benign
R6603:Ap3d1 UTSW 10 80,549,881 (GRCm39) missense probably benign 0.04
R6887:Ap3d1 UTSW 10 80,559,532 (GRCm39) missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80,577,767 (GRCm39) missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80,553,693 (GRCm39) missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80,559,637 (GRCm39) missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80,566,716 (GRCm39) missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80,577,734 (GRCm39) missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80,557,426 (GRCm39) missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80,558,755 (GRCm39) missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80,545,292 (GRCm39) missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80,553,678 (GRCm39) missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80,565,891 (GRCm39) missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80,550,135 (GRCm39) missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80,558,766 (GRCm39) nonsense probably null
R8314:Ap3d1 UTSW 10 80,559,373 (GRCm39) missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80,568,737 (GRCm39) missense probably damaging 1.00
R8896:Ap3d1 UTSW 10 80,552,425 (GRCm39) missense probably benign 0.01
R8936:Ap3d1 UTSW 10 80,547,952 (GRCm39) missense probably benign 0.02
R9183:Ap3d1 UTSW 10 80,545,627 (GRCm39) missense probably null 0.06
R9209:Ap3d1 UTSW 10 80,554,918 (GRCm39) missense probably benign 0.04
R9259:Ap3d1 UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R9476:Ap3d1 UTSW 10 80,545,655 (GRCm39) missense probably benign 0.00
R9645:Ap3d1 UTSW 10 80,545,062 (GRCm39) missense probably benign
R9664:Ap3d1 UTSW 10 80,548,639 (GRCm39) missense possibly damaging 0.71
R9781:Ap3d1 UTSW 10 80,545,609 (GRCm39) missense possibly damaging 0.51
X0019:Ap3d1 UTSW 10 80,554,936 (GRCm39) missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80,556,981 (GRCm39) missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80,555,071 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCAGCTTCACATACTGGTCTGAC -3'
(R):5'- TTTGGCTTTAACCCTAACTGTAGC -3'

Sequencing Primer
(F):5'- CATACTGGTCTGACATGGGCATAC -3'
(R):5'- AGCAAGGTTACAGTTAGCTCCTGC -3'
Posted On 2018-10-18