Mutagenetix > Incidental Mutation

Incidental Mutation 'R7040:Dnah7b'

546979

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

LOC227058, Dnahc7b

MMRRC Submission

045013-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R7040 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46105475-46412710 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 46275969 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 2619 (E2619Q)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069293
AA Change: E2619Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: E2619Q

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	G	7: 127,835,897 (GRCm39)	L232P	possibly damaging	Het
Acaa1a	T	C	9: 119,178,104 (GRCm39)	V312A	probably damaging	Het
Bmp2	A	G	2: 133,403,604 (GRCm39)	D385G	probably damaging	Het
C1qtnf9	T	C	14: 61,017,241 (GRCm39)	V257A	probably damaging	Het
Cd3d	G	A	9: 44,896,991 (GRCm39)	V122I	probably damaging	Het
Cdc37	T	C	9: 21,053,519 (GRCm39)	E199G	probably damaging	Het
Crb2	T	A	2: 37,677,696 (GRCm39)	D326E	probably benign	Het
Cyp2c29	A	C	19: 39,318,781 (GRCm39)	K420N	possibly damaging	Het
Cyp2g1	A	C	7: 26,520,184 (GRCm39)	D472A	probably damaging	Het
Dab2	A	C	15: 6,451,732 (GRCm39)	H116P	probably damaging	Het
Dsg4	A	T	18: 20,584,909 (GRCm39)	M208L	probably benign	Het
Eif4enif1	T	G	11: 3,184,040 (GRCm39)	V521G	probably benign	Het
Fan1	T	A	7: 64,022,234 (GRCm39)	N340Y	probably damaging	Het
Fpr-rs6	A	G	17: 20,403,196 (GRCm39)	M55T	probably damaging	Het
Grhpr	A	G	4: 44,985,362 (GRCm39)	S101G	probably damaging	Het
Kif15	T	A	9: 122,840,679 (GRCm39)	D33E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,758,813 (GRCm39)		probably benign	Het
Lama4	A	G	10: 38,936,158 (GRCm39)	Q611R	possibly damaging	Het
Lrrc47	T	A	4: 154,104,909 (GRCm39)	*123R	probably null	Het
Map4k3	A	C	17: 80,988,344 (GRCm39)	V36G	probably damaging	Het
Mme	T	A	3: 63,276,344 (GRCm39)	I707N	probably damaging	Het
Muc2	A	G	7: 141,305,194 (GRCm39)	E166G	unknown	Het
Mucl1	T	A	15: 103,783,844 (GRCm39)	T108S	possibly damaging	Het
Myo1h	A	T	5: 114,497,805 (GRCm39)	D53V	possibly damaging	Het
Naa15	T	A	3: 51,380,205 (GRCm39)	L811Q	possibly damaging	Het
Nalcn	T	C	14: 123,525,267 (GRCm39)	T1487A	probably benign	Het
Nme8	A	T	13: 19,878,498 (GRCm39)	L87H	probably damaging	Het
Nr2e1	A	G	10: 42,444,374 (GRCm39)	V245A	probably damaging	Het
Nt5c2	A	T	19: 46,881,974 (GRCm39)	F291Y	possibly damaging	Het
Ooep	T	C	9: 78,285,683 (GRCm39)	N43S	possibly damaging	Het
Or10ak13	T	C	4: 118,639,183 (GRCm39)	M200V	probably benign	Het
Or4e1	T	C	14: 52,700,932 (GRCm39)	D178G	possibly damaging	Het
Or52i2	A	T	7: 102,319,937 (GRCm39)	Q270L	probably benign	Het
Or52n2c	A	T	7: 104,574,717 (GRCm39)	C85S	probably benign	Het
Ovch2	A	T	7: 107,395,772 (GRCm39)	I82N	probably damaging	Het
Palb2	A	T	7: 121,713,622 (GRCm39)	M524K	possibly damaging	Het
Patj	T	C	4: 98,329,317 (GRCm39)	S524P	probably benign	Het
Patl1	T	A	19: 11,907,318 (GRCm39)	Y401N	possibly damaging	Het
Pcdhb20	A	T	18: 37,637,770 (GRCm39)	T99S	probably benign	Het
Plcb4	G	A	2: 135,774,182 (GRCm39)	A155T	probably benign	Het
Rpap3	A	G	15: 97,576,993 (GRCm39)	V585A	possibly damaging	Het
Sorbs1	G	C	19: 40,365,244 (GRCm39)	R180G	probably benign	Het
Spen	T	A	4: 141,221,693 (GRCm39)	T302S	unknown	Het
Tenm4	G	A	7: 96,202,703 (GRCm39)	R106H	probably benign	Het
Ube2o	T	C	11: 116,432,686 (GRCm39)	E760G	probably benign	Het
Uimc1	T	A	13: 55,223,267 (GRCm39)		probably null	Het
Usp16	C	T	16: 87,277,817 (GRCm39)	A689V	probably damaging	Het
Vmn2r60	G	A	7: 41,791,666 (GRCm39)	A530T	probably benign	Het
Vps8	T	A	16: 21,393,772 (GRCm39)	M1185K	probably damaging	Het
Vwa8	T	C	14: 79,149,645 (GRCm39)	S136P	probably damaging	Het
Ythdc2	A	G	18: 44,967,529 (GRCm39)	N175S	probably benign	Het
Zfp160	A	T	17: 21,246,794 (GRCm39)	H448L	probably damaging	Het
Zfp90	T	A	8: 107,151,641 (GRCm39)	C451*	probably null	Het
Zfp945	A	G	17: 23,071,264 (GRCm39)	C212R	probably damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46,181,309 (GRCm39)	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46,250,497 (GRCm39)	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46,263,811 (GRCm39)	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46,105,889 (GRCm39)	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46,253,482 (GRCm39)	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46,234,538 (GRCm39)	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46,120,592 (GRCm39)	splice site	probably benign
IGL01392:Dnah7b	APN	1	46,165,948 (GRCm39)	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46,155,460 (GRCm39)	splice site	probably benign
IGL01460:Dnah7b	APN	1	46,178,864 (GRCm39)	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46,307,813 (GRCm39)	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46,397,307 (GRCm39)	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46,397,297 (GRCm39)	nonsense	probably null
IGL01906:Dnah7b	APN	1	46,214,613 (GRCm39)	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46,163,497 (GRCm39)	splice site	probably benign
IGL01989:Dnah7b	APN	1	46,328,694 (GRCm39)	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46,179,035 (GRCm39)	missense	probably benign
IGL02213:Dnah7b	APN	1	46,272,752 (GRCm39)	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46,266,090 (GRCm39)	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46,138,663 (GRCm39)	nonsense	probably null
IGL02381:Dnah7b	APN	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46,273,353 (GRCm39)	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46,234,478 (GRCm39)	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46,162,937 (GRCm39)	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46,155,461 (GRCm39)	splice site	probably benign
IGL02704:Dnah7b	APN	1	46,181,293 (GRCm39)	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46,138,768 (GRCm39)	splice site	probably benign
IGL02745:Dnah7b	APN	1	46,234,189 (GRCm39)	splice site	probably benign
IGL02818:Dnah7b	APN	1	46,329,968 (GRCm39)	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46,158,458 (GRCm39)	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46,221,535 (GRCm39)	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46,124,849 (GRCm39)	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46,158,464 (GRCm39)	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46,412,508 (GRCm39)	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46,252,520 (GRCm39)	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46,262,338 (GRCm39)	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46,258,508 (GRCm39)	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46,162,937 (GRCm39)	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46,246,803 (GRCm39)	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46,173,816 (GRCm39)	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46,280,104 (GRCm39)	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46,316,286 (GRCm39)	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46,275,948 (GRCm39)	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46,179,336 (GRCm39)	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46,258,704 (GRCm39)	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46,280,152 (GRCm39)	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46,379,292 (GRCm39)	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46,138,772 (GRCm39)	splice site	probably benign
R1035:Dnah7b	UTSW	1	46,163,608 (GRCm39)	missense	probably benign
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46,364,970 (GRCm39)	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46,379,280 (GRCm39)	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46,138,669 (GRCm39)	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46,328,816 (GRCm39)	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46,117,753 (GRCm39)	splice site	probably benign
R1484:Dnah7b	UTSW	1	46,176,703 (GRCm39)	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46,216,441 (GRCm39)	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46,105,957 (GRCm39)	missense	unknown
R1607:Dnah7b	UTSW	1	46,329,806 (GRCm39)	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46,392,126 (GRCm39)	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46,214,550 (GRCm39)	nonsense	probably null
R1681:Dnah7b	UTSW	1	46,363,872 (GRCm39)	nonsense	probably null
R1716:Dnah7b	UTSW	1	46,230,943 (GRCm39)	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46,272,919 (GRCm39)	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46,316,265 (GRCm39)	missense	probably damaging	1.00
R1838:Dnah7b	UTSW	1	46,155,337 (GRCm39)	missense	probably benign	0.04
R1898:Dnah7b	UTSW	1	46,275,874 (GRCm39)	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46,281,263 (GRCm39)	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46,181,247 (GRCm39)	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46,281,481 (GRCm39)	nonsense	probably null
R2083:Dnah7b	UTSW	1	46,280,227 (GRCm39)	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46,137,152 (GRCm39)	splice site	probably benign
R2172:Dnah7b	UTSW	1	46,163,672 (GRCm39)	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46,240,344 (GRCm39)	splice site	probably benign
R2247:Dnah7b	UTSW	1	46,316,223 (GRCm39)	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46,273,075 (GRCm39)	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46,402,114 (GRCm39)	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46,234,447 (GRCm39)	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46,178,901 (GRCm39)	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46,246,732 (GRCm39)	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46,227,847 (GRCm39)	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46,221,583 (GRCm39)	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46,307,869 (GRCm39)	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46,392,033 (GRCm39)	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46,339,035 (GRCm39)	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46,282,417 (GRCm39)	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46,176,645 (GRCm39)	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46,272,871 (GRCm39)	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46,120,655 (GRCm39)	missense	probably benign
R4172:Dnah7b	UTSW	1	46,266,106 (GRCm39)	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46,176,578 (GRCm39)	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46,260,932 (GRCm39)	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
R4414:Dnah7b	UTSW	1	46,165,840 (GRCm39)	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46,124,792 (GRCm39)	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46,328,696 (GRCm39)	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46,117,684 (GRCm39)	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46,256,317 (GRCm39)	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46,250,488 (GRCm39)	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46,246,816 (GRCm39)	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46,106,115 (GRCm39)	missense	unknown
R4780:Dnah7b	UTSW	1	46,392,174 (GRCm39)	missense	probably benign
R4828:Dnah7b	UTSW	1	46,167,272 (GRCm39)	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46,395,762 (GRCm39)	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46,234,234 (GRCm39)	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46,120,604 (GRCm39)	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46,240,478 (GRCm39)	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46,329,935 (GRCm39)	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46,272,886 (GRCm39)	missense	probably benign
R5000:Dnah7b	UTSW	1	46,138,663 (GRCm39)	nonsense	probably null
R5005:Dnah7b	UTSW	1	46,281,188 (GRCm39)	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46,226,523 (GRCm39)	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46,221,540 (GRCm39)	nonsense	probably null
R5174:Dnah7b	UTSW	1	46,282,509 (GRCm39)	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46,397,376 (GRCm39)	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46,273,018 (GRCm39)	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46,412,514 (GRCm39)	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46,272,849 (GRCm39)	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46,256,351 (GRCm39)	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46,227,819 (GRCm39)	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46,397,431 (GRCm39)	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46,281,366 (GRCm39)	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46,281,179 (GRCm39)	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46,148,472 (GRCm39)	missense	probably null
R5479:Dnah7b	UTSW	1	46,262,265 (GRCm39)	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46,281,359 (GRCm39)	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46,395,674 (GRCm39)	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46,307,924 (GRCm39)	splice site	probably null
R5659:Dnah7b	UTSW	1	46,392,009 (GRCm39)	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46,273,152 (GRCm39)	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46,181,292 (GRCm39)	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46,230,885 (GRCm39)	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46,376,753 (GRCm39)	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46,260,803 (GRCm39)	missense	probably benign
R5941:Dnah7b	UTSW	1	46,226,450 (GRCm39)	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46,402,147 (GRCm39)	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46,158,558 (GRCm39)	splice site	probably null
R6041:Dnah7b	UTSW	1	46,328,805 (GRCm39)	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46,178,949 (GRCm39)	missense	probably benign
R6049:Dnah7b	UTSW	1	46,124,762 (GRCm39)	missense	probably benign
R6131:Dnah7b	UTSW	1	46,292,626 (GRCm39)	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46,329,863 (GRCm39)	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46,272,745 (GRCm39)	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46,165,828 (GRCm39)	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46,265,048 (GRCm39)	missense	probably benign
R6273:Dnah7b	UTSW	1	46,281,476 (GRCm39)	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46,379,335 (GRCm39)	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46,281,364 (GRCm39)	nonsense	probably null
R6494:Dnah7b	UTSW	1	46,138,591 (GRCm39)	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46,263,902 (GRCm39)	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46,379,377 (GRCm39)	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46,230,948 (GRCm39)	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46,234,280 (GRCm39)	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46,158,428 (GRCm39)	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46,397,398 (GRCm39)	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46,234,299 (GRCm39)	critical splice donor site	probably null
R7117:Dnah7b	UTSW	1	46,391,973 (GRCm39)	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46,178,870 (GRCm39)	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46,281,302 (GRCm39)	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46,179,126 (GRCm39)	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46,122,914 (GRCm39)	missense	probably benign
R7244:Dnah7b	UTSW	1	46,316,303 (GRCm39)	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46,181,245 (GRCm39)	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46,234,532 (GRCm39)	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46,342,794 (GRCm39)	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46,214,579 (GRCm39)	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46,329,894 (GRCm39)	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46,364,925 (GRCm39)	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46,395,714 (GRCm39)	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46,163,506 (GRCm39)	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46,253,573 (GRCm39)	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46,307,794 (GRCm39)	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46,148,462 (GRCm39)	missense	probably benign
R7676:Dnah7b	UTSW	1	46,273,324 (GRCm39)	nonsense	probably null
R7731:Dnah7b	UTSW	1	46,178,905 (GRCm39)	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46,240,413 (GRCm39)	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46,176,634 (GRCm39)	missense	probably benign
R7807:Dnah7b	UTSW	1	46,253,527 (GRCm39)	missense	probably benign
R7895:Dnah7b	UTSW	1	46,289,110 (GRCm39)	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46,178,838 (GRCm39)	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46,266,163 (GRCm39)	missense	probably benign
R7946:Dnah7b	UTSW	1	46,272,739 (GRCm39)	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46,282,584 (GRCm39)	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46,282,525 (GRCm39)	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46,263,866 (GRCm39)	nonsense	probably null
R8094:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46,272,913 (GRCm39)	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46,292,671 (GRCm39)	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46,395,736 (GRCm39)	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46,179,032 (GRCm39)	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46,214,456 (GRCm39)	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46,395,819 (GRCm39)	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46,227,839 (GRCm39)	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46,329,875 (GRCm39)	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46,138,650 (GRCm39)	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46,155,360 (GRCm39)	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46,214,598 (GRCm39)	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46,221,624 (GRCm39)	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46,392,159 (GRCm39)	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46,162,806 (GRCm39)	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46,273,305 (GRCm39)	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46,230,953 (GRCm39)	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46,280,236 (GRCm39)	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46,292,534 (GRCm39)	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46,262,232 (GRCm39)	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46,282,575 (GRCm39)	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46,173,674 (GRCm39)	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46,266,180 (GRCm39)	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46,181,194 (GRCm39)	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46,330,038 (GRCm39)	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46,361,420 (GRCm39)	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46,272,914 (GRCm39)	nonsense	probably null
R9392:Dnah7b	UTSW	1	46,162,898 (GRCm39)	nonsense	probably null
R9456:Dnah7b	UTSW	1	46,165,953 (GRCm39)	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46,253,564 (GRCm39)	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46,264,956 (GRCm39)	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46,292,621 (GRCm39)	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46,252,544 (GRCm39)	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
RF020:Dnah7b	UTSW	1	46,412,421 (GRCm39)	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46,412,458 (GRCm39)	nonsense	probably null
X0023:Dnah7b	UTSW	1	46,342,737 (GRCm39)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TAGTCATGGCCAGAAGATGC -3'
(R):5'- TTACACCCAAGAATAGACTGCTTCC -3'

Sequencing Primer
(F):5'- GCTTCAAGGTTCCTGGAAGAC -3'
(R):5'- AGAATAGACTGCTTCCTACCATG -3'

Posted On

2019-05-13