Incidental Mutation 'R7169:Brsk1'
ID558120
Institutional Source Beutler Lab
Gene Symbol Brsk1
Ensembl Gene ENSMUSG00000035390
Gene NameBR serine/threonine kinase 1
SynonymsSAD-B, LOC381979
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7169 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4690604-4715997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4715404 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 751 (S751P)
Ref Sequence ENSEMBL: ENSMUSP00000039517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048248] [ENSMUST00000086363] [ENSMUST00000086364] [ENSMUST00000120836]
Predicted Effect probably benign
Transcript: ENSMUST00000048248
AA Change: S751P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039517
Gene: ENSMUSG00000035390
AA Change: S751P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 13 30 N/A INTRINSIC
S_TKc 34 285 6.75e-103 SMART
low complexity region 330 344 N/A INTRINSIC
low complexity region 430 457 N/A INTRINSIC
low complexity region 492 517 N/A INTRINSIC
low complexity region 523 552 N/A INTRINSIC
low complexity region 668 686 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086363
SMART Domains Protein: ENSMUSP00000083549
Gene: ENSMUSG00000046456

DomainStartEndE-ValueType
Pfam:Frag1 4 207 7.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086364
SMART Domains Protein: ENSMUSP00000083550
Gene: ENSMUSG00000046456

DomainStartEndE-ValueType
Pfam:Frag1 4 114 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120836
AA Change: S676P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113448
Gene: ENSMUSG00000035390
AA Change: S676P

DomainStartEndE-ValueType
S_TKc 1 210 1.19e-71 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
low complexity region 448 477 N/A INTRINSIC
low complexity region 593 611 N/A INTRINSIC
low complexity region 671 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123637
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Cdh20 G A 1: 104,947,353 A287T possibly damaging Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Dpm1 A T 2: 168,211,423 Y207* probably null Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Eya4 A T 10: 23,155,947 N236K probably benign Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkd1l2 T A 8: 117,040,835 T1239S possibly damaging Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pop5 T A 5: 115,240,228 V77E possibly damaging Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Brsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Brsk1 APN 7 4704261 missense probably benign 0.03
IGL01733:Brsk1 APN 7 4706072 missense probably damaging 1.00
IGL03019:Brsk1 APN 7 4710497 intron probably benign
IGL03088:Brsk1 APN 7 4710454 intron probably benign
R0612:Brsk1 UTSW 7 4707426 missense possibly damaging 0.96
R0891:Brsk1 UTSW 7 4704227 missense possibly damaging 0.95
R1455:Brsk1 UTSW 7 4704251 missense probably damaging 1.00
R1728:Brsk1 UTSW 7 4704219 missense probably damaging 1.00
R2884:Brsk1 UTSW 7 4691123 unclassified probably benign
R2939:Brsk1 UTSW 7 4708140 missense possibly damaging 0.53
R4392:Brsk1 UTSW 7 4698750 missense probably damaging 1.00
R4661:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4662:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4756:Brsk1 UTSW 7 4708867 missense possibly damaging 0.72
R4788:Brsk1 UTSW 7 4698955 splice site probably null
R5026:Brsk1 UTSW 7 4704266 missense probably damaging 1.00
R5248:Brsk1 UTSW 7 4708866 missense possibly damaging 0.53
R5267:Brsk1 UTSW 7 4704709 missense probably damaging 1.00
R5419:Brsk1 UTSW 7 4709004 missense possibly damaging 0.53
R5430:Brsk1 UTSW 7 4710436 missense probably benign 0.00
R5625:Brsk1 UTSW 7 4706400 missense probably damaging 1.00
R5659:Brsk1 UTSW 7 4715372 missense possibly damaging 0.93
R6700:Brsk1 UTSW 7 4692701 missense probably damaging 0.99
R6866:Brsk1 UTSW 7 4706407 missense probably damaging 0.98
Z1088:Brsk1 UTSW 7 4707372 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGGACATAATAACCTCTATTCTGGTTG -3'
(R):5'- AGGCCTAGTTTTGTGTCCCC -3'

Sequencing Primer
(F):5'- TGGTGACAAGCTCTGCTGAAC -3'
(R):5'- CCTCCCAACATACTCCTTGG -3'
Posted On2019-06-26