Incidental Mutation 'R7208:Scara3'
ID560887
Institutional Source Beutler Lab
Gene Symbol Scara3
Ensembl Gene ENSMUSG00000034463
Gene Namescavenger receptor class A, member 3
SynonymsC130058N24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172604; MGI: 2444418

Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7208 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65919394-65953935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65931266 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 301 (V301I)
Ref Sequence ENSEMBL: ENSMUSP00000046525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042046
AA Change: V301I

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046525
Gene: ENSMUSG00000034463
AA Change: V301I

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
coiled coil region 117 155 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Collagen 455 513 3.1e-12 PFAM
Pfam:Collagen 499 558 4.2e-11 PFAM
Pfam:Collagen 544 606 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,308,645 probably null Het
Aass T C 6: 23,074,630 K854E probably damaging Het
Abcd2 G T 15: 91,190,682 Y309* probably null Het
Ache G A 5: 137,291,489 G360D probably damaging Het
Acot12 T C 13: 91,781,242 L396P probably benign Het
Acox2 T G 14: 8,241,303 D603A probably benign Het
Adam3 C A 8: 24,711,401 K245N probably damaging Het
Ankhd1 T C 18: 36,625,028 I925T probably benign Het
Arhgap27 C T 11: 103,360,759 V48M probably damaging Het
Atm A T 9: 53,512,008 probably null Het
B4galt4 T A 16: 38,753,940 F92Y probably damaging Het
Brwd1 C T 16: 96,035,959 R891Q probably damaging Het
Calcr T C 6: 3,687,612 Q462R probably benign Het
Ccdc112 T C 18: 46,287,631 R351G probably damaging Het
Ccdc80 T G 16: 45,096,710 S610A probably benign Het
Cdh20 C A 1: 104,954,071 N420K possibly damaging Het
Cntn3 G A 6: 102,278,422 R172* probably null Het
Ctnnd1 G T 2: 84,622,046 Q78K possibly damaging Het
D16Ertd472e A T 16: 78,575,926 L41H probably damaging Het
Dclk2 A T 3: 86,799,602 probably null Het
Dmwd C T 7: 19,080,309 H295Y probably benign Het
Dnaic2 T C 11: 114,757,162 V588A unknown Het
Dtx4 C T 19: 12,482,073 probably null Het
Dync2h1 C A 9: 7,141,059 D1323Y probably damaging Het
Fcgbp T A 7: 28,104,021 H1683Q probably benign Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Gm4070 A C 7: 105,902,179 S555R possibly damaging Het
Gm9195 A G 14: 72,451,752 S1876P possibly damaging Het
Grhl2 A C 15: 37,335,736 K431T probably damaging Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gtf2ird1 T C 5: 134,411,094 N94S probably benign Het
Hmgcs1 G T 13: 119,701,084 G195W probably damaging Het
Hrc A T 7: 45,336,565 Y380F possibly damaging Het
Kcnu1 C T 8: 25,919,637 Q863* probably null Het
Lemd2 G A 17: 27,196,191 P300L probably damaging Het
Lnpep A T 17: 17,552,910 Y665* probably null Het
Lrfn1 A G 7: 28,467,139 T653A probably benign Het
Ly6g6c A G 17: 35,067,411 T8A unknown Het
Mcm5 T C 8: 75,121,716 probably null Het
Med28 A T 5: 45,523,452 D86V probably damaging Het
Mup11 A G 4: 60,659,726 S171P possibly damaging Het
Nckap1 A G 2: 80,540,198 F383L probably benign Het
Nid1 G C 13: 13,468,385 G303R probably benign Het
Nkain3 A G 4: 20,282,892 V147A probably benign Het
Olfr361 A G 2: 37,085,658 V30A probably benign Het
Pde9a G A 17: 31,420,284 V63I possibly damaging Het
Pdlim2 T A 14: 70,174,377 I69F probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phf20l1 T C 15: 66,604,789 I245T probably benign Het
Prmt8 C T 6: 127,689,829 R394H possibly damaging Het
Prpf4b T A 13: 34,884,011 D274E unknown Het
Psmd6 A T 14: 14,112,225 probably null Het
Rgs16 T C 1: 153,741,670 L69P probably damaging Het
Robo3 A T 9: 37,424,724 I482N probably damaging Het
Serpina1b T A 12: 103,728,294 H397L probably benign Het
Skint11 T A 4: 114,231,747 L246Q probably damaging Het
Skint5 T A 4: 113,539,339 R1212S unknown Het
Slc11a2 T C 15: 100,402,332 D348G probably benign Het
Slc15a2 T C 16: 36,756,281 K495E probably benign Het
Son T G 16: 91,662,102 D2072E unknown Het
Stau1 A G 2: 166,963,574 V34A probably damaging Het
Stk3 G T 15: 35,073,116 L153I possibly damaging Het
Swi5 A T 2: 32,287,910 V13E probably benign Het
Syne2 A T 12: 76,031,398 probably null Het
Synm T C 7: 67,734,915 M558V probably benign Het
Tep1 T A 14: 50,824,556 probably null Het
Tmc6 A G 11: 117,776,325 V149A probably benign Het
Tmem214 T A 5: 30,870,721 V95E possibly damaging Het
Tnnt2 T A 1: 135,850,376 probably null Het
Txlna A G 4: 129,631,278 probably null Het
Vmn2r26 T C 6: 124,061,989 I841T probably damaging Het
Wasf2 G A 4: 133,195,734 V452I probably damaging Het
Wdr62 C T 7: 30,252,336 D673N probably damaging Het
Wdr78 T G 4: 103,066,352 I427L probably benign Het
Wdr95 C T 5: 149,595,371 T559I probably benign Het
Zbtb40 A T 4: 136,999,626 probably null Het
Zfat T C 15: 68,180,007 E646G probably benign Het
Other mutations in Scara3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Scara3 APN 14 65933121 missense probably benign 0.01
IGL00646:Scara3 APN 14 65921156 nonsense probably null
IGL00718:Scara3 APN 14 65931427 missense possibly damaging 0.67
IGL01948:Scara3 APN 14 65930812 missense probably damaging 0.99
IGL01979:Scara3 APN 14 65930963 missense probably benign 0.01
IGL02399:Scara3 APN 14 65933110 nonsense probably null
IGL02939:Scara3 APN 14 65931656 missense probably benign 0.00
IGL02945:Scara3 APN 14 65931211 missense probably damaging 1.00
IGL03075:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03100:Scara3 APN 14 65931273 missense probably damaging 1.00
IGL03156:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03179:Scara3 APN 14 65931154 missense probably damaging 1.00
PIT4362001:Scara3 UTSW 14 65936402 missense probably benign
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0124:Scara3 UTSW 14 65931221 missense probably benign 0.01
R0349:Scara3 UTSW 14 65931781 missense probably damaging 0.98
R1584:Scara3 UTSW 14 65921104 missense probably damaging 1.00
R4785:Scara3 UTSW 14 65953501 start codon destroyed probably null 0.06
R5336:Scara3 UTSW 14 65931038 missense probably damaging 1.00
R6307:Scara3 UTSW 14 65938261 missense probably benign 0.24
R6420:Scara3 UTSW 14 65938252 missense possibly damaging 0.92
R6610:Scara3 UTSW 14 65931221 missense probably damaging 0.97
R7159:Scara3 UTSW 14 65920780 missense probably damaging 0.98
R7246:Scara3 UTSW 14 65931644 missense probably damaging 0.97
R7315:Scara3 UTSW 14 65931440 missense probably damaging 1.00
R7324:Scara3 UTSW 14 65931416 missense probably benign 0.03
YA93:Scara3 UTSW 14 65930949 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTGAAGATAGTGCCGATTTCAATC -3'
(R):5'- AGACTGCTGAGTGGATCCAC -3'

Sequencing Primer
(F):5'- GCCGATTTCAATCTCATGAGAAGC -3'
(R):5'- GACAGATGAGGAGACCCTGACC -3'
Posted On2019-06-26