Incidental Mutation 'R7263:Elf5'
ID564729
Institutional Source Beutler Lab
Gene Symbol Elf5
Ensembl Gene ENSMUSG00000027186
Gene NameE74-like factor 5
SynonymsESE-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103411688-103450989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103439300 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 75 (N75K)
Ref Sequence ENSEMBL: ENSMUSP00000028609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028609] [ENSMUST00000126290] [ENSMUST00000164172] [ENSMUST00000171693]
Predicted Effect probably benign
Transcript: ENSMUST00000028609
AA Change: N75K

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028609
Gene: ENSMUSG00000027186
AA Change: N75K

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126290
AA Change: N75K

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118565
Gene: ENSMUSG00000027186
AA Change: N75K

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 199 4.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164172
AA Change: N75K

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126941
Gene: ENSMUSG00000027186
AA Change: N75K

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171693
AA Change: N75K

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131940
Gene: ENSMUSG00000027186
AA Change: N75K

DomainStartEndE-ValueType
SAM_PNT 35 119 3.89e-39 SMART
ETS 160 246 4.96e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. Embryos homozygous for one null allele failed to develop extraembryonic ectoderm, did not maintain trophoblast stem cells, and had abnormal or absent mesoderm. Mice heterozygous for another allele had impaired lactation and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Elf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Elf5 APN 2 103442861 splice site probably benign
IGL03162:Elf5 APN 2 103430406 missense possibly damaging 0.56
R0329:Elf5 UTSW 2 103430420 splice site probably benign
R4667:Elf5 UTSW 2 103449060 missense probably damaging 1.00
R4906:Elf5 UTSW 2 103449573 nonsense probably null
R5768:Elf5 UTSW 2 103449022 missense probably damaging 1.00
R6307:Elf5 UTSW 2 103439412 missense probably damaging 1.00
R6418:Elf5 UTSW 2 103439352 missense possibly damaging 0.92
R6526:Elf5 UTSW 2 103439233 missense probably damaging 1.00
R6708:Elf5 UTSW 2 103448989 missense probably damaging 0.97
R7199:Elf5 UTSW 2 103439296 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GTAAGTGCATGCCAGACCTAG -3'
(R):5'- ATATCAGGTCCCAGTCCTAGG -3'

Sequencing Primer
(F):5'- GACCTAGAGCCCTTTCTGAATAGG -3'
(R):5'- GTCCCAGTCCTAGGCCCTC -3'
Posted On2019-06-26