Incidental Mutation 'R7275:Bche'
ID565501
Institutional Source Beutler Lab
Gene Symbol Bche
Ensembl Gene ENSMUSG00000027792
Gene Namebutyrylcholinesterase
SynonymsC730038G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7275 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location73635808-73708415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73700636 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 486 (T486S)
Ref Sequence ENSEMBL: ENSMUSP00000029367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029367] [ENSMUST00000138216]
Predicted Effect probably benign
Transcript: ENSMUST00000029367
AA Change: T486S

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029367
Gene: ENSMUSG00000027792
AA Change: T486S

DomainStartEndE-ValueType
Pfam:COesterase 10 551 5.2e-183 PFAM
Pfam:Abhydrolase_3 139 242 1.9e-7 PFAM
Pfam:AChE_tetra 566 602 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138216
SMART Domains Protein: ENSMUSP00000141329
Gene: ENSMUSG00000027792

DomainStartEndE-ValueType
Pfam:COesterase 10 174 6.9e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Gpat2 G C 2: 127,431,367 G224R possibly damaging Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Other mutations in Bche
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Bche APN 3 73701307 missense probably benign 0.00
IGL01420:Bche APN 3 73702009 missense probably benign 0.03
IGL02433:Bche APN 3 73701929 missense probably benign 0.02
IGL02734:Bche APN 3 73702076 missense probably benign 0.09
IGL03095:Bche APN 3 73701883 missense probably damaging 1.00
IGL03227:Bche APN 3 73701612 missense probably damaging 1.00
R0056:Bche UTSW 3 73701321 missense possibly damaging 0.79
R1780:Bche UTSW 3 73700620 missense probably benign 0.00
R1984:Bche UTSW 3 73701826 missense probably benign 0.03
R1984:Bche UTSW 3 73701827 missense probably benign
R2403:Bche UTSW 3 73701472 missense probably damaging 0.96
R4989:Bche UTSW 3 73701844 missense probably benign 0.02
R5231:Bche UTSW 3 73700861 missense probably benign 0.07
R5363:Bche UTSW 3 73700639 missense probably damaging 0.98
R5987:Bche UTSW 3 73648678 missense possibly damaging 0.59
R6164:Bche UTSW 3 73701056 missense possibly damaging 0.63
R6381:Bche UTSW 3 73701799 missense probably benign 0.00
R6571:Bche UTSW 3 73701491 missense probably benign 0.08
R6801:Bche UTSW 3 73701800 missense probably benign
R6935:Bche UTSW 3 73701800 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTAAAATTCACCACATTGTGAG -3'
(R):5'- ACATCATCTGCCCTGCACTG -3'

Sequencing Primer
(F):5'- TTCACCACATTGTGAGACAAAAAGG -3'
(R):5'- CCTGCACTGGAGTTTACCAAG -3'
Posted On2019-06-26