Incidental Mutation 'R7303:Ang'
ID567126
Institutional Source Beutler Lab
Gene Symbol Ang
Ensembl Gene ENSMUSG00000072115
Gene Nameangiogenin, ribonuclease, RNase A family, 5
SynonymsAng1, Rnase5a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51091150-51102009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51101516 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 38 (H38L)
Ref Sequence ENSEMBL: ENSMUSP00000067434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022428] [ENSMUST00000069011] [ENSMUST00000169895] [ENSMUST00000171688]
PDB Structure
MURINE ANGIOGENIN, SULPHATE COMPLEX [X-RAY DIFFRACTION]
MURINE ANGIOGENIN, PHOSPHATE COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022428
SMART Domains Protein: ENSMUSP00000022428
Gene: ENSMUSG00000021876

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
RNAse_Pc 30 148 8.54e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069011
AA Change: H38L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000067434
Gene: ENSMUSG00000072115
AA Change: H38L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
RNAse_Pc 26 142 6.52e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169895
SMART Domains Protein: ENSMUSP00000127274
Gene: ENSMUSG00000021876

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
RNAse_Pc 30 148 8.54e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171688
AA Change: H38L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132084
Gene: ENSMUSG00000072115
AA Change: H38L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
RNAse_Pc 26 142 6.52e-65 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the pancreatic ribonuclease A superfamily and is a potent inducer of neovascularization. The encoded protein is a secreted multifunctional tRNA-specific ribonuclease that promotes angiogenesis in response to angiogenetic stimuli such as hypoxia, mediates stress-induced translational repression by cleaving cellular tRNAs, stimulates cell proliferation by mediating rRNA transcription in prostate cancer cells, and is involved in neurite pathfinding. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the ribonuclease, RNase A family 4 gene. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. Multiple pseudogenes have been found for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Aldh16a1 A T 7: 45,147,904 L160Q probably damaging Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mapkapk5 T C 5: 121,540,574 E13G probably benign Het
Mark3 T C 12: 111,655,536 V704A probably damaging Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr1087 A G 2: 86,690,822 V51A probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pepd T C 7: 35,021,772 probably null Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Spef2 T A 15: 9,647,490 I944F possibly damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Ang
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Ang APN 14 51101667 nonsense probably null
R1716:Ang UTSW 14 51101480 missense probably benign 0.01
R1716:Ang UTSW 14 51101500 missense probably damaging 1.00
R1989:Ang UTSW 14 51101551 missense probably damaging 1.00
R2407:Ang UTSW 14 51101646 nonsense probably null
R2860:Ang UTSW 14 51101818 missense probably damaging 1.00
R2861:Ang UTSW 14 51101818 missense probably damaging 1.00
R2862:Ang UTSW 14 51101818 missense probably damaging 1.00
R5807:Ang UTSW 14 51101429 intron probably benign
R7322:Ang UTSW 14 51101411 missense unknown
X0024:Ang UTSW 14 51101575 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCCACCCACTTAGTCTAAGTTAG -3'
(R):5'- TGCAAGTGGTGACCTGGAAG -3'

Sequencing Primer
(F):5'- TTAGAAAGTGGTTCTACAGCCGACC -3'
(R):5'- CCTGGAAGGGAGACTTGCTCATTC -3'
Posted On2019-06-26