Incidental Mutation 'R7388:Cdk5rap1'
ID573237
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene NameCDK5 regulatory subunit associated protein 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R7388 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location154335380-154373010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154360675 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 212 (R212W)
Ref Sequence ENSEMBL: ENSMUSP00000028990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109730] [ENSMUST00000109731]
Predicted Effect probably damaging
Transcript: ENSMUST00000028990
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487
AA Change: R212W

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109730
SMART Domains Protein: ENSMUSP00000105352
Gene: ENSMUSG00000027487

DomainStartEndE-ValueType
Pfam:UPF0004 100 181 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109731
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487
AA Change: R212W

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Fam159a G A 4: 108,367,822 T181I possibly damaging Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Olfr30 C T 11: 58,455,655 C98Y probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154366036 missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154335569 missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154365960 critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154370702 missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154360599 missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154360654 missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154370695 missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154352251 missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154353246 missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154348716 missense probably damaging 1.00
R4126:Cdk5rap1 UTSW 2 154368895 missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154361835 makesense probably null
R4865:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154368874 missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154342395 missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154335569 missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154350835 missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154345974 missense probably benign 0.01
R5780:Cdk5rap1 UTSW 2 154345868 frame shift probably null
R6262:Cdk5rap1 UTSW 2 154370686 missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154368241 missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154360732 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCAAGCATATACTATCGCAGC -3'
(R):5'- GCAGTTATAAATCATGTGCACTGAGC -3'

Sequencing Primer
(F):5'- GCTACTTAGAGAAACCCTGTCTGG -3'
(R):5'- GCACTGAGCAAAAGCCAG -3'
Posted On2019-09-13