Incidental Mutation 'R0239:Mrrf'
ID59195
Institutional Source Beutler Lab
Gene Symbol Mrrf
Ensembl Gene ENSMUSG00000026887
Gene Namemitochondrial ribosome recycling factor
Synonyms2400002D02Rik
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R0239 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36136389-36190647 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 36177281 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028250]
PDB Structure
Solution structure of RSGI RUH-021, a domain II of ribosome recycling factor from mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028250
SMART Domains Protein: ENSMUSP00000028250
Gene: ENSMUSG00000026887

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:RRF 99 261 3.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribosome recycling factor, which is a component of the mitochondrial translational machinery. The encoded protein, along with mitochondrial elongation factor 2, functions in ribosomal recycling at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Greb1l C T 18: 10,458,567 probably benign Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Klc1 A G 12: 111,785,324 probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Mfsd7a G T 5: 108,444,016 probably benign Het
Micu2 G A 14: 57,917,378 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Pzp C T 6: 128,489,156 probably benign Het
Raet1c C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Scgb1b2 T A 7: 31,291,730 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Mrrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Mrrf APN 2 36141631 missense possibly damaging 0.82
R0370:Mrrf UTSW 2 36177113 critical splice acceptor site probably null
R0671:Mrrf UTSW 2 36153698 missense probably benign 0.01
R2517:Mrrf UTSW 2 36189097 missense probably benign 0.07
R4823:Mrrf UTSW 2 36148030 missense possibly damaging 0.93
R5552:Mrrf UTSW 2 36147961 missense possibly damaging 0.85
R6056:Mrrf UTSW 2 36177221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACATCTGTCAGCAGTGTGAAGG -3'
(R):5'- GCTTGCAGAAGTCCCCAAACTTCC -3'

Sequencing Primer
(F):5'- CTGACGGCTCAGAGTTATAGACTG -3'
(R):5'- GCAGCCTCTAACTGATTTGGTAG -3'
Posted On2013-07-11