Incidental Mutation 'R0239:Map2'
ID59188
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R0239 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66416106 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1385 (D1385G)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: D1385G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: D1385G

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Greb1l C T 18: 10,458,567 probably benign Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Klc1 A G 12: 111,785,324 probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Mfsd7a G T 5: 108,444,016 probably benign Het
Micu2 G A 14: 57,917,378 probably benign Het
Mrrf T C 2: 36,177,281 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Pzp C T 6: 128,489,156 probably benign Het
Raet1c C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Scgb1b2 T A 7: 31,291,730 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCGACCTGCTTGTTTCAGAAAG -3'
(R):5'- AGGAGTGGAAATTCTGCCTCTCCC -3'

Sequencing Primer
(F):5'- AGTTTGTGGAGACCTGCCC -3'
(R):5'- CTAACTGCTCTGTCAAGATGC -3'
Posted On2013-07-11