Incidental Mutation 'R0689:Snx6'
ID61290
Institutional Source Beutler Lab
Gene Symbol Snx6
Ensembl Gene ENSMUSG00000005656
Gene Namesorting nexin 6
Synonyms2810425K19Rik, 2010006G21Rik, 2610032J07Rik
MMRRC Submission 038874-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R0689 (G1)
Quality Score86
Status Validated
Chromosome12
Chromosomal Location54746349-54795703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54763656 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 112 (S112T)
Ref Sequence ENSEMBL: ENSMUSP00000151488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005798] [ENSMUST00000218934] [ENSMUST00000219781]
Predicted Effect probably benign
Transcript: ENSMUST00000005798
AA Change: S228T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005798
Gene: ENSMUSG00000005656
AA Change: S228T

DomainStartEndE-ValueType
Pfam:PX 29 170 2.8e-21 PFAM
Pfam:Vps5 184 399 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218337
Predicted Effect probably benign
Transcript: ENSMUST00000218934
AA Change: S112T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219722
Predicted Effect probably benign
Transcript: ENSMUST00000219781
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Bpifc A G 10: 85,960,547 probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Liph T C 16: 21,968,068 Y268C probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myo9b G A 8: 71,330,756 D574N probably damaging Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Olfr726 A T 14: 50,084,232 F150I probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgip1 A T 4: 102,966,252 D690V probably damaging Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Sox6 A G 7: 115,486,551 V685A probably damaging Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Snx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Snx6 APN 12 54754309 missense probably damaging 0.99
IGL02682:Snx6 APN 12 54754345 missense probably damaging 1.00
IGL02995:Snx6 APN 12 54795510 splice site probably benign
IGL03240:Snx6 APN 12 54783443 missense probably damaging 0.98
IGL03353:Snx6 APN 12 54765684 splice site probably benign
PIT4362001:Snx6 UTSW 12 54768030 missense possibly damaging 0.80
R0458:Snx6 UTSW 12 54768136 nonsense probably null
R0610:Snx6 UTSW 12 54751789 missense probably damaging 1.00
R1818:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R1819:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R4946:Snx6 UTSW 12 54770743 missense probably damaging 1.00
R5275:Snx6 UTSW 12 54784022 missense probably damaging 1.00
R5373:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5374:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5497:Snx6 UTSW 12 54757061 missense probably damaging 0.98
R5907:Snx6 UTSW 12 54754319 missense probably damaging 1.00
R5947:Snx6 UTSW 12 54770764 nonsense probably null
R6178:Snx6 UTSW 12 54760464 missense probably damaging 0.99
R6287:Snx6 UTSW 12 54747028 missense possibly damaging 0.75
R6321:Snx6 UTSW 12 54752013 missense probably damaging 1.00
R6878:Snx6 UTSW 12 54763601 intron probably null
R7055:Snx6 UTSW 12 54784079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCATGTCATAGATCACTGTCC -3'
(R):5'- GCTAAAGTCTGCTAAAGTCTCGCCG -3'

Sequencing Primer
(F):5'- tcacaaccacctccaactc -3'
(R):5'- CCGTGCCAATGGCGTAAAG -3'
Posted On2013-07-30